Sequences
EST Library Info
cbe4Cerebellum
cut1Uterus - RNA from China
dbla1Unavailable
ecc1Foetus 50 days, cortex cerebri
eje1Foetus 50 days, jejunum
eru1Foetus 50 days, regio umbilicalis
fat1Fatt
fcc1Unavailable
fce1Foetus 100 days, cerebellum
fhi1Unavailable
hlv1Heart, left ventricle
lin3Large intestine
nco2Newborn 115 days, colon
pfco3Unavailable
rec1Rectum
relu1Unavailable
ute1Uterus
Clusters
Oligos
SNPs

Gene ID ENSG00000164919 (click for geneview)
Transcript ID ENST00000297564(link to ensembl)
Symbol COX6C
Localtion Chromosome:8:100959548:100975071:-1 band: 8q22.2
Description Cytochrome c oxidase polypeptide VIc precursor (EC 1.9.3.1). [Source:Uniprot/SWISSPROT;Acc:P09669]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--A--P--E--V--L--P--K--P--R--M--R--G--L--L--A--R--R--L--R--N--H--M--A--V--A--F--V--L--S--L--G--V--
ATGGCTCCCGAAGTTTTGCCAAAACCTCGGATGCGTGGCCTTCTGGCCAGGCGTCTGCGAAATCATATGGCTGTAGCATTCGTGCTATCCCTGGGGGTTG
               ::: : :::::::.::::::::::::::::::::.::::::::::  :::::: :.:: :::::::.:  : :: .:::::::::
---------------TTGACCAAACCTCAGATGCGTGGCCTTCTGGCCAAGCGTCTGCGATTTCATATTGTTGGAGCATTCATTGTCTCATTGGGGGTTG
----------------L--T--K--P--Q--M--R--G--L--L--A--K--R--L--R--F--H--I--V--G--A--F--I--V--S--L--G--V--

-------------><-------------------------------------------------------------------------------------
A--A--L--Y--K--F--R--V--A--D--Q--R--K--K--A--Y--A--D--F--Y--R--N--Y--D--V--M--K--D--F--E--E--M--R--K
CAGCTTTGTATAAGTTTCGTGTGGCTGATCAAAGAAAGAAGGCATACGCAGATTTCTACAGAAACTACGATGTCATGAAAGATTTTGAGGAGATGAGGAA
::.:::: :::::::::  ::::::::: : :::::::::::::::::::::::::::::::::.::.::: .:::::::::::::::::::::::::::
CAACTTTCTATAAGTTTGCTGTGGCTGAACCAAGAAAGAAGGCATACGCAGATTTCTACAGAAATTATGATTCCATGAAAGATTTTGAGGAGATGAGGAA
A--T--F--Y--K--F--A--V--A--E--P--R--K--K--A--Y--A--D--F--Y--R--N--Y--D--S--M--K--D--F--E--E--M--R--K

--------------------------->
--A--G--I--F--Q--S--V--K--*-
GGCTGGTATCTTTCAGAGTGTAAAGTAA
::::::::::::::::::::..::::.:
GGCTGGTATCTTTCAGAGTGCGAAGTGA
--A--G--I--F--Q--S--A--K--*-

Pig Consensus Sequence

>BGISUST0000895201
---------------TTGACCAAACCTCAGATGCGTGGCCTTCTGGCCAAGCGTCTGCGATTTCATATTGTTGGAGCATTCATTGTCTCATTGGGGGTTG
CAACTTTCTATAAGTTTGCTGTGGCTGAACCAAGAAAGAAGGCATACGCAGATTTCTACAGAAATTATGATTCCATGAAAGATTTTGAGGAGATGAGGAA
GGCTGGTATCTTTCAGAGTGCGAAGTGA


>BGISUSP0000895201
-----LTKPQMRGLLAKRLRFHIVGAFIVSLGVATFYKFAVAEPRKKAYADFYRNYDSMKDFEEMRKAGIFQSAK*