Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000165445 (click for geneview)
Transcript ID ENST00000298211(link to ensembl)
Localtion Chromosome:10:35294003:35295193:1 band: 10p11.21
Description  
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--A--S--G--N--M--H--I--G--K--L--T--P--D--F--K--A--T--A--V--V--D--G--T--Y--R--E--V--K--L--L--D--Y--
ATGGCCTCCGGTAACATGCACATTGGAAAGCTCACCCCTGACTTCAAGGCCACTGCCGTGGTGGATGGCACCTACAGGGAGGTAAAGCTGTTGGACTACA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------><---------------------------------------------------------
R--G--K--H--V--V--L--F--S--I--L--W--T--S--Q--I--I--A--F--S--D--H--A--E--G--F--R--K--L--Q--S--A--G--D
GAGGGAAGCACGTGGTCCTCTTTTCCATCCTCTGGACTTCACAGATCATCGCATTCAGCGACCATGCTGAGGGCTTCCGAAAGCTGCAAAGTGCTGGGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------><----------------------------------------------------------------------------------------><--
--L--G--A--Q--F--T--H--L--A--W--I--N--I--P--R--K--E--G--G--F--E--S--L--D--T--P--L--L--A--D--V--T--K-
CCTCGGTGCTCAGTTCACCCACCTGGCTTGGATCAACATCCCCCGGAAGGAGGGAGGCTTTGAGTCCCTGGACACCCCTCTGCTTGCTGACGTGACCAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------><-------------------------------------------
-L--S--E--N--Y--G--V--L--K--T--D--E--G--I--V--C--R--G--L--D--L--F--I--I--H--G--K--D--V--L--P--Q--I--
TTGTCTGAGAATTACGGCGTGTTGAAAACAGACGAGGGCATTGTCTGCAGGGGCTTGGACCTCTTTATCATCCATGGCAAGGATGTCCTTCCCCAGATCG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
A--V--N--D--W--P--V--G--H--F--V--D--E--A--L--R--L--V--Q--A--F--Q--Y--T--D--E--H--P--E--I--C--P--A--G
CTGTTAATGATTGGCCTGTGGGACACTTTGTGGATGAGGCCCTGCGGCTGGTCCAGGCCTTCCAGTACACAGACGAGCACCCGGAAATTTGTCCTGCTGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------------------>
--W--K--P--G--S--D--M--I--K--P--S--V--N--D--S--K--E--Y--F--S--K--H--N--*-
CTGGAAGCCTGGCAGTGACATGATCAAGCCCAGCGTGAATGACAGCAAGGAATATTTCTCCAAACACAACTAG
                                                                         
-------------------------------------------------------------------------
-------------------------------------------------------------------------