Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000165548 (click for geneview)
Transcript ID ENST00000298351(link to ensembl)
Symbol NP_065164.1
Localtion Chromosome:14:76717923:76795591:1 band: 14q24.3
Description  
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-D--P--P--R--M--S--A--S--P--D--D--L--S--T--G--G--R--L--Q--N--M--T--V--D--E--C--F--Q--S--R--N--T--V--
GATCCTCCCAGGATGTCTGCCTCACCAGACGACCTGAGTACAGGGGGAAGGTTACAGAACATGACAGTGGATGAATGCTTCCAGTCTCGGAACACCGTCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------><-------------------------------------
L--Q--G--Q--P--F--G--G--V--P--T--V--L--C--L--N--I--A--L--W--V--L--V--L--V--V--Y--S--F--L--R-----K--A
TCCAGGGGCAGCCCTTTGGGGGTGTCCCCACCGTGCTGTGCCTCAACATCGCCCTGTGGGTGCTCGTCCTTGTGGTTTACTCCTTCCTCCGG---AAAGC
                                                                 .:: :: ::::::::::::::::::::   :::::
-----------------------------------------------------------------ATCATTTTGGTTTACTCCTTCCTCCGGG--AAAGC
------------------------------------------------------------------I--I--L--V--Y--S--F--L--R--\--K--A

--------------------------------------------><------------------------------------------------------
--A--W--D--Y--G--R--L--A--L--L--I--H--N--D--S--L--T--S--L--I--Y--G--E--Q--S--E--K--T--S--P--S--E--T-
TGCGTGGGACTATGGGCGCCTGGCTCTGCTGATACACAATGACAGCCTGACCTCGCTGATCTATGGGGAGCAGAGCGAGAAGACATCTCCCTCGGAGACT
.:::::::::::::::::::::::::::::::: :::::.:::                                                         
CGCGTGGGACTATGGGCGCCTGGCTCTGCTGATCCACAACGAC---------------------------------------------------------
--A--W--D--Y--G--R--L--A--L--L--I--H--N--D----------------------------------------------------------

--------------------------><------------------------------------><----------------------------------
-S--L--E--M--E--R--R--D--K--G--F--C--S--W--F--F--N--S--I--T--M--K--D--E--D--L--I--N--K--C--G--D--D--
TCCTTGGAGATGGAACGCAGAGACAAGGGATTCTGTTCCTGGTTCTTCAACAGCATAACAATGAAGGACGAGGATCTGATTAACAAGTGTGGGGACGACG
                                                                  .::::.::::::::::.:::::::::.:::::.:
------------------------------------------------------------------AACGAAGATCTGATTAGCAAGTGTGGAGACGATG
-------------------------------------------------------------------N--E--D--L--I--S--K--C--G--D--D--

----------------------------------------------------------------------------------------------------
A--R--I--Y--I--V--F--Q--Y--H--L--I--I--F--V--L--I--I--C--I--P--S--L--G--I--I--L--P--I--N--Y--T--G--S
CACGCATCTACATCGTGTTCCAGTACCACCTCATCATCTTTGTGCTCATCATCTGTATCCCCTCCCTGGGCATCATTTTGCCCATCAACTATACTGGATC
: ::.:::::::::..:::::::::.::.::::::.::::::::::.::: ::::..::::::::::::::::::::::::::::::::::.::::::  
CCCGTATCTACATCACGTTCCAGTATCATCTCATCGTCTTTGTGCTTATCCTCTGCGTCCCCTCCCTGGGCATCATTTTGCCCATCAACTACACTGGAAA
A--R--I--Y--I--T--F--Q--Y--H--L--I--V--F--V--L--I--L--C--V--P--S--L--G--I--I--L--P--I--N--Y--T--G--N

-------><-----------------------------------------------><------------------------------------------
--V--L--D--W--S--S--H--F--A--R--T--T--I--V--N--V--S--T--E--S--K--L--L--W--L--H--S--L--L--S--F--F--Y-
TGTTCTGGACTGGAGCAGTCACTTTGCTCGGACCACCATTGTCAATGTCTCCACAGAGAGCAAGCTCCTGTGGCTGCATAGCCTGCTGTCCTTCTTCTAC
:::::::   ::::..:::::::::: :::::::::::::::::::::: :::::                                             
TGTTCTG---TGGAATAGTCACTTTGGTCGGACCACCATTGTCAATGTCGCCACA---------------------------------------------
--V--L-----W--N--S--H--F--G--R--T--T--I--V--N--V--A--T----------------------------------------------

-----------------------------------------------------------------><---------------------------------
-F--I--T--N--F--M--F--M--A--H--H--C--L--G--F--A--P--R--N--S--Q--K--V--T--R--T--L--M--I--T--Y--V--P--
TTCATCACCAACTTCATGTTCATGGCTCATCACTGCCTGGGGTTTGCACCCAGGAATAGCCAAAAGGTCACAAGGACACTAATGATCACCTATGTGCCCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------><-----------------------------------------------------------
K--D--I--E--D--P--E--L--I--I--K--H--F--H--E--A--Y--P--G--S--V--V--T--R--V--H--F--C--Y--D--V--R--N--L
AGGACATTGAAGACCCAGAACTCATCATTAAGCATTTTCACGAGGCCTATCCAGGCAGTGTCGTGACAAGAGTCCACTTCTGCTACGACGTCAGGAACCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------><------------------------------------------------------------------------------
--I--D--L--D--D--Q--R--R--H--A--M--R--G--R--L--F--Y--T--A--K--A--K--K--T--G--K--V--M--I--R--I--H--P-
GATCGACTTGGACGATCAGAGGCGCCATGCCATGCGGGGCCGGCTTTTCTATACAGCCAAGGCCAAGAAGACTGGGAAGGTGATGATCAGGATCCACCCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------><------------------------------------------------------
-C--A--R--L--C--F--C--K--C--W--T--C--F--K--E--V--D--A--E--Q--Y--Y--S--E--L--E--E--Q--L--T--D--E--F--
TGTGCCCGCCTGTGCTTCTGCAAGTGCTGGACCTGCTTCAAGGAGGTGGATGCAGAGCAGTATTACAGCGAGCTAGAGGAGCAGCTAACGGACGAGTTCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------------------------><--------------------
N--A--E--L--N--R--V--P--L--K--R--L--D--L--I--F--V--T--F--Q--D--S--R--M--A--K--R--V--R--K--D--Y--K--Y
ACGCCGAGCTCAACCGCGTGCCGCTCAAGCGGCTGGACCTGATCTTTGTCACCTTCCAGGACTCCAGGATGGCCAAGCGTGTCCGTAAGGATTACAAGTA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--V--Q--C--G--V--Q--P--Q--Q--S--S--V--T--T--I--V--K--S--Y--Y--W--R--V--T--M--A--P--H--P--K--D--I--I-
TGTCCAGTGTGGTGTGCAACCCCAGCAGTCCTCAGTGACCACCATCGTCAAATCATATTACTGGAGGGTCACTATGGCCCCACACCCCAAAGACATTATT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-><-------------------------------------------------------------------------------------------------
-W--K--H--L--S--V--R--R--F--F--W--W--A--R--F--I--A--I--N--T--F--L--F--F--L--F--F--F--L--T--T--P--A--
TGGAAACACCTGTCTGTCCGCCGCTTCTTTTGGTGGGCCCGCTTTATCGCAATCAACACCTTCCTCTTCTTCCTCTTCTTCTTTCTCACCACGCCTGCCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------><-------------------------------------------
I--I--M--N--T--I--D--M--Y--N--V--T--R--P--I--E--K--L--Q--N--P--I--V--T--Q--F--F--P--S--V--M--L--W--G
TCATCATGAACACTATCGACATGTACAACGTCACCCGCCCCATCGAGAAGCTGCAGAACCCAATTGTGACCCAGTTCTTCCCCTCTGTGATGCTCTGGGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------><------------------------------------
--F--T--V--I--L--P--L--I--V--Y--F--S--A--F--L--E--A--H--W--T--R--S--S--Q--N--L--V--M--V--H--K--C--Y-
CTTCACAGTGATACTGCCTCTGATTGTCTACTTCTCCGCCTTCCTCGAGGCCCACTGGACCAGATCAAGTCAGAATCTGGTCATGGTGCACAAGTGCTAC
                                                                :::::::::::::::.::::.::::::::.::::::
----------------------------------------------------------------TCAAGTCAGAATCTGATCATAGTGCACAAATGCTAC
-----------------------------------------------------------------S--S--Q--N--L--I--I--V--H--K--C--Y-

-------------------------------------------------><-------------------------------------------------
-I--F--L--V--F--M--V--V--I--L--P--S--M--G--L--T--S--L--D--V--F--L--R--W--L--F--D--I--Y--Y--L--E--Q--
ATCTTTCTGGTGTTCATGGTAGTCATTCTGCCCTCTATGGGACTGACCAGTTTGGATGTCTTTCTCCGCTGGCTCTTTGACATCTACTATCTAGAGCAAG
::::::::::::::::::::.:::::::::::::::::::::::::::   ::::::::::::.::::::::::::::::::::::::::::.::.::.:
ATCTTTCTGGTGTTCATGGTGGTCATTCTGCCCTCTATGGGACTGACC---TTGGATGTCTTTTTCCGCTGGCTCTTTGACATCTACTATCTGGAACAGG
-I--F--L--V--F--M--V--V--I--L--P--S--M--G--L--T-----L--D--V--F--F--R--W--L--F--D--I--Y--Y--L--E--Q--

---------------><-----------------------------------------------------------------------------------
A--S--I--R--F--Q--C--V--F--L--P--D--N--G--A--F--F--V--N--Y--V--I--T--A--A--L--L--G--T--G--M--E--L--L
CATCCATCAGGTTCCAGTGTGTGTTCCTGCCAGACAACGGCGCCTTCTTTGTCAACTACGTGATCACGGCAGCTTTACTTGGCACAGGCATGGAGCTGCT
::::::::::::::                                                                                      
CATCCATCAGGTTC--------------------------------------------------------------------------------------
A--S--I--R--F---------------------------------------------------------------------------------------

------------------------------------------------------------------------------><--------------------
--R--L--G--S--L--F--C--Y--S--T--R--L--F--F--S--R--S--E--P--E--R--V--N--I--R--K--N--Q--A--I--D--F--Q-
GCGTCTGGGGTCACTCTTCTGCTACAGCACCCGCCTCTTCTTCTCTAGATCAGAGCCAGAGAGAGTCAACATCAGAAAGAACCAGGCCATAGACTTCCAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------------------------------><--------------
-F--G--R--E--Y--A--W--M--M--N--V--F--S--V--V--M--A--Y--S--I--T--C--P--I--I--V--P--F--G--L--L--Y--L--
TTTGGGCGTGAGTATGCGTGGATGATGAACGTGTTCAGCGTGGTGATGGCGTACAGCATCACTTGCCCCATCATTGTGCCTTTTGGGTTGCTCTACCTGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
C--M--K--H--L--T--D--R--Y--N--M--Y--Y--S--F--A--P--T--K--L--N--E--Q--I--H--M--A--A--V--S--Q--A--I--F
GCATGAAGCACTTGACGGATCGCTATAACATGTACTACTCCTTTGCACCCACCAAACTGAACGAGCAGATCCACATGGCTGCCGTCTCCCAGGCCATCTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------><----------------------------------------------
--A--P--L--L--G--L--F--W--M--L--F--F--S--I--L--R--L--G--S--L--H--A--I--T--I--F--S--L--S--T--L--L--I-
TGCGCCACTCTTGGGTCTGTTCTGGATGCTGTTCTTCTCCATCCTGCGGTTGGGTTCTCTCCACGCCATCACCATCTTTTCCCTGTCCACCCTCCTCATT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------><------------------------------------
-A--M--V--I--A--F--V--G--I--F--L--G--K--L--R--M--V--A--D--Y--E--P--E--E--E--E--I--Q--T--V--F--D--M--
GCCATGGTGATTGCCTTTGTTGGCATTTTTCTGGGGAAGCTTCGGATGGTTGCCGACTACGAGCCCGAGGAGGAGGAGATCCAGACAGTGTTTGACATGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------><----------------------------------------------------------------
E--P--S--S--T--S--S--T--P--T--S--L--L--Y--V--A--T--V--L--Q--E--P--E--L--N--L--T--P--A--S--S--P--A--R
AGCCAAGCAGCACCTCCTCCACGCCCACCTCCCTCCTGTATGTGGCCACCGTGCTGCAAGAACCGGAGTTGAATCTGACCCCCGCCTCCTCCCCAGCCAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--H--T--Y--G--T--M--N--N--Q--P--E--E--G--E--E--E--S--G--L--R--G--F--A--R--E--L--D--S--A--Q--F--Q--E-
GCACACCTATGGCACCATGAACAACCAGCCGGAAGAGGGAGAAGAAGAGAGTGGTCTGAGGGGCTTTGCGAGGGAGCTAGACTCGGCCCAGTTCCAGGAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------->
-G--L--E--L--E--G--Q--N--Q--Y--H--*-
GGGCTGGAACTGGAGGGCCAGAACCAGTACCACTGA
                                    
------------------------------------
------------------------------------

Pig Consensus Sequence

>BGISUST0000881844
----------------------------------------------------------------------------------------------------
-----------------------------------------------------------------ATCATTTTGGTTTACTCCTTCCTCCGgaAAGCCGC
GTGGGACTATGGGCGCCTGGCTCTGCTGATCCACAACGAC------------------------------------------------------------
---------------------------------------------------------------AACGAAGATCTGATTAGCAAGTGTGGAGACGATGCCC
GTATCTACATCACGTTCCAGTATCATCTCATCGTCTTTGTGCTTATCCTCTGCGTCCCCTCCCTGGGCATCATTTTGCCCATCAACTACACTGGAAATGT
TCTG---TGGAATAGTCACTTTGGTCGGACCACCATTGTCAATGTCGCCACA------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
-------------------------------------------------------------TCAAGTCAGAATCTGATCATAGTGCACAAATGCTACATC
TTTCTGGTGTTCATGGTGGTCATTCTGCCCTCTATGGGACTGACC---TTGGATGTCTTTTTCCGCTGGCTCTTTGACATCTACTATCTGGAACAGGCAT
CCATCAGGTTC-----------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
---------------------------------


>BGISUSP0000881844
-------------------------------------------------------IILVYSFLRKAAWDYGRLALLIHND--------------------
---------------------NEDLISKCGDDARIYITFQYHLIVFVLILCVPSLGIILPINYTGNVL-WNSHFGRTTIVNVAT----------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
---------------------------------------------------------------------------------------SSQNLIIVHKCYI
FLVFMVVILPSMGLT-LDVFFRWLFDIYYLEQASIRF---------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
-----------