Sequences
EST Library Info
cje1Jejunum - RNA from China
fcc1Unavailable
jej1Small intestine, jejunum
med1Mediastinum
mga1Mammary gland - 7 days after weaning
thg1Thyroid gland
Clusters
Oligos
SNPs

Gene ID ENSG00000165898 (click for geneview)
Transcript ID ENST00000298818(link to ensembl)
Symbol HBLD1
Localtion Chromosome:14:74030216:74031456:1 band: 14q24.3
Description HESB like domain containing 1 [Source:RefSeq_peptide;Acc:NP_919255]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<------------------------------------------------------------------------------------><-------------
-S--L--W--R--K--M--A--A--A--W--G--S--S--L--T--A--A--T--Q--R--A--V--T--P--W--P--R--G--R--L--L--T--A--
AGCTTGTGGAGGAAGATGGCTGCCGCCTGGGGGTCGTCCCTAACGGCCGCGACGCAGAGAGCGGTCACTCCCTGGCCGAGGGGCAGGCTCCTCACGGCCT
                                                                                       ::::::.::::::
---------------------------------------------------------------------------------------CTCCTCGCGGCCT
----------------------------------------------------------------------------------------L--L--A--A--

----------------------------------------------------------------------------------------><----------
S--L--G--P--Q--A--R--R--E--A--S--S--S--S--P--E--A--G--E--G--Q--I--R--L--T--D--S--C--V--Q--R--L--L--E
CCCTGGGACCCCAGGCGCGTCGGGAGGCGTCGTCCTCCAGCCCCGAGGCCGGCGAAGGGCAGATCCGCCTCACAGACAGTTGCGTCCAGAGGCTTTTGGA
:.:  :::::...::: : ::::::...:::::::::::.:::.::.::.::::::::::::::::.:::.:: :::::.:::::::::::::::.::::
CTCGCGGACCTTGGGCTCTTCGGGAAATGTCGTCCTCCAACCCTGAAGCTGGCGAAGGGCAGATCCACCTTACCGACAGCTGCGTCCAGAGGCTTCTGGA
S--R--G--P--W--A--L--R--E--M--S--S--S--N--P--E--A--G--E--G--Q--I--H--L--T--D--S--C--V--Q--R--L--L--E

----------------------------------------------------------------------------------------------------
--I--T--E--G--S--E--F--L--R--L--Q--V--E--G--G--G--C--S--G--F--Q--Y--K--F--S--L--D--T--V--I--N--P--D-
AATCACCGAAGGGTCAGAATTCCTCAGGCTGCAAGTGGAGGGAGGTGGATGCTCCGGATTCCAATACAAATTTTCACTGGATACAGTTATCAACCCCGAC
:::::::::::::::::::::::::::.::: :.::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::::
AATCACCGAAGGGTCAGAATTCCTCAGACTGGAGGTGGAGGGAGGTGGATGCTCCGGATTCCAATACAAATTTTCACTGGATACAGTTATCAACCCCGAC
--I--T--E--G--S--E--F--L--R--L--E--V--E--G--G--G--C--S--G--F--Q--Y--K--F--S--L--D--T--V--I--N--P--D-

--------><-------><---------------------------------------------------------------------------------
-D--R--Q--E--E--G--G--G--A--R--V--V--V--D--S--D--S--L--A--F--V--K--G--A--Q--V--D--F--S--Q--E--L--I--
GACAGGCAAGAGGAAGGGGGTGGGGCAAGAGTGGTGGTTGACTCTGATAGCTTGGCCTTCGTGAAAGGGGCCCAGGTGGACTTCAGCCAAGAACTGATCC
:::::::::         :::::::::::::::::::::::.::::::::::::::::::::::::::::::::::::::::::::.:::::::::::::
GACAGGCAA---------GGTGGGGCAAGAGTGGTGGTTGATTCTGATAGCTTGGCCTTCGTGAAAGGGGCCCAGGTGGACTTCAGTCAAGAACTGATCC
-D--R--Q-----------G--G--A--R--V--V--V--D--S--D--S--L--A--F--V--K--G--A--Q--V--D--F--S--Q--E--L--I--

------------------------------------------------------------------------------->
R--S--S--F--Q--V--L--N--N--P--Q--A--Q--Q--G--C--S--C--G--S--S--F--S--I--K--L--*-
GAAGCTCATTTCAAGTGTTGAACAATCCTCAAGCACAGCAAGGCTGCTCCTGTGGGTCATCTTTCTCTATCAAACTTTGA
::::::::::::::::::::::::::::::::::.::::::::::::::::::::::::::.::::::.:.:::::::::
GAAGCTCATTTCAAGTGTTGAACAATCCTCAAGCGCAGCAAGGCTGCTCCTGTGGGTCATCCTTCTCTGTTAAACTTTGA
R--S--S--F--Q--V--L--N--N--P--Q--A--Q--Q--G--C--S--C--G--S--S--F--S--V--K--L--*-

Pig Consensus Sequence

>BGISUST0000881266
---------------------------------------------------------------------------------------CTCCTCGCGGCCT
CTCGCGGACCTTGGGCTCTTCGGGAAATGTCGTCCTCCAACCCTGAAGCTGGCGAAGGGCAGATCCACCTTACCGACAGCTGCGTCCAGAGGCTTCTGGA
AATCACCGAAGGGTCAGAATTCCTCAGACTGGAGGTGGAGGGAGGTGGATGCTCCGGATTCCAATACAAATTTTCACTGGATACAGTTATCAACCCCGAC
GACAGGCAA---------GGTGGGGCAAGAGTGGTGGTTGATTCTGATAGCTTGGCCTTCGTGAAAGGGGCCCAGGTGGACTTCAGTCAAGAACTGATCC
GAAGCTCATTTCAAGTGTTGAACAATCCTCAAGCGCAGCAAGGCTGCTCCTGTGGGTCATCCTTCTCTGTTAAACTTTGA


>BGISUSP0000881266
-----------------------------LLAASRGPWALREMSSSNPEAGEGQIHLTDSCVQRLLEITEGSEFLRLEVEGGGCSGFQYKFSLDTVINPD
DRQ---GGARVVVDSDSLAFVKGAQVDFSQELIRSSFQVLNNPQAQQGCSCGSSFSVKL*