Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000096148 (click for geneview)
Transcript ID ENST00000299289(link to ensembl)
Symbol G6B_HUMAN
Localtion Chromosome:6:31799129:31802468:1 band: 6p21.33
Description G6b protein precursor. [Source:Uniprot/SWISSPROT;Acc:O95866]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-----------------------------------------------------------><--------------------------------------
-M--A--V--F--L--Q--L--L--P--L--L--L--S--R--A--Q--G--N--P--G--A--S--L--D--G--R--P--G--D--R--V--N--L--
ATGGCTGTGTTTCTGCAGCTGCTACCGCTGCTGCTCTCGAGGGCCCAAGGGAACCCTGGGGCTTCTCTGGACGGCCGCCCTGGGGACCGGGTGAATCTCT
                                                               :: ::::: ::.::::: :::::.::.:: :::::::
---------------------------------------------------------------TCACTGGAAGGTCGCCCGGGGGATCGAGTCAATCTCT
----------------------------------------------------------------S--L--E--G--R--P--G--D--R--V--N--L--

----------------------------------------------------------------------------------------------------
S--C--G--G--V--S--H--P--I--R--W--V--W--A--P--S--F--P--A--C--K--G--L--S--K--G--R--R--P--I--L--W--A--S
CCTGCGGAGGAGTCTCTCATCCCATCCGCTGGGTCTGGGCACCCAGCTTCCCGGCCTGCAAGGGCCTGTCCAAAGGACGCCGACCGATCCTGTGGGCCTC
:::::: ::..::::: :: ::::.:::.::::::::::::::.:::::::::::::::::::::::::::::::: ::::: : :::.::::::.: ::
CCTGCGTAGAGGTCTCGCAACCCACCCGTTGGGTCTGGGCACCTAGCTTCCCGGCCTGCAAGGGCCTGTCCAAAGGCCGCCGCCGGATTCTGTGGACATC
S--C--V--E--V--S--Q--P--T--R--W--V--W--A--P--S--F--P--A--C--K--G--L--S--K--G--R--R--R--I--L--W--T--S

----------------------------------------------------------------------------------------------------
--S--S--G--T--P--T--V--P--P--L--Q--P--F--V--G--R--L--R--S--L--D--S--G--I--R--R--L--E--L--L--L--S--A-
TTCGAGCGGGACCCCCACCGTGCCTCCCCTCCAGCCTTTCGTCGGCCGCCTACGCTCCCTGGACTCTGGTATCCGGCGGCTGGAGCTCCTCTTGAGCGCG
 ::::..::.: :::::::::..:: :: .::::::.::.:: :::::::::::. ::::::.:..::::::.:::::::::::::: :::.: ::::::
ATCGAATGGAAACCCCACCGTATCTGCCGCCCAGCCCTTTGTGGGCCGCCTACGTGCCCTGGGCCTTGGTATTCGGCGGCTGGAGCTGCTCCTCAGCGCG
--S--N--G--N--P--T--V--S--A--A--Q--P--F--V--G--R--L--R--A--L--G--L--G--I--R--R--L--E--L--L--L--S--A-

----------------------------------------------------------------------------------------------------
-G--D--S--G--T--F--F--C--K--G--R--H--E--D--E--S--R--T--V--L--H--V--L--G--D--R--T--Y--C--K--A--P--G--
GGGGACTCGGGCACTTTTTTCTGCAAGGGCCGCCACGAGGACGAGAGCCGTACAGTGCTTCACGTGCTGGGGGACAGGACCTATTGCAAGGCCCCCGGGC
::::::::::::::.::: ..::::::::::.: . .:::::::::::::::: :::::::.:::::::::::::  :.:  ::::::::::.:: :.::
GGGGACTCGGGCACCTTTACTTGCAAGGGCCACGGAAAGGACGAGAGCCGTACTGTGCTTCGCGTGCTGGGGGACCCGGCAGATTGCAAGGCTCCGGAGC
-G--D--S--G--T--F--T--C--K--G--H--G--K--D--E--S--R--T--V--L--R--V--L--G--D--P--A--D--C--K--A--P--E--

--------><----------------------------------------------------------------------------------------->
P--T--H--G--S--V--Y--P--Q--L--L--I--P--L--L--G--A--G--L--V--L--G--L--G--A--L--G--L--V--W--W--L--H--R
CTACCCATGGGTCCGTGTATCCCCAGCTCCTGATCCCGCTGCTGGGCGCTGGGTTGGTGCTCGGACTGGGAGCTTTGGGCCTGGTCTGGTGGCTGCACAG
:::::                                                                                               
CTACC-----------------------------------------------------------------------------------------------
P--T------------------------------------------------------------------------------------------------

<---------------------------------------><----------------------------------------------------------
--R--L--P--P--Q--P--I--R--P--L--P--R--F--A--P--L--V--K--T--E--P--Q--R--P--V--K--E--E--E--P--K--I--P-
GCGCCTGCCCCCGCAACCGATTCGACCACTCCCTAGATTTGCTCCACTTGTGAAAACCGAGCCCCAGAGGCCAGTAAAGGAGGAAGAGCCCAAGATTCCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------><------------------------------------------------------------------------------
-G--D--L--D--Q--E--P--S--L--L--Y--A--D--L--D--H--L--A--L--S--R--P--R--R--L--S--T--A--D--P--A--D--A--
GGGGACCTGGACCAGGAACCGAGCCTGCTCTATGCGGATCTGGACCATCTAGCCCTCAGCAGGCCCCGCCGGCTGTCCACAGCGGACCCTGCTGATGCCT
                     :::::::::::.::.::.:::::.:::  .:::::::: :: :: ::::: :::::.  .:.:: ::::::::: ::::
---------------------AGCCTGCTCTACGCAGACCTGGATCATAGGGCCCTCAGAAGTCCGCGCCGTCTGTCTCGGGTGGTCCCTGCTGAGGCCT
----------------------S--L--L--Y--A--D--L--D--H--R--A--L--R--S--P--R--R--L--S--R--V--V--P--A--E--A--

------------------------->
S--T--I--Y--A--V--V--V--*-
CCACCATCTATGCAGTTGTAGTTTGA
:::::::::::::.:::::.::::::
CCACCATCTATGCGGTTGTGGTTTGA
S--T--I--Y--A--V--V--V--*-

Pig Consensus Sequence

>BGISUST0000884120
---------------------------------------------------------------TCACTGGAAGGTCGCCCGGGGGATCGAGTCAATCTCT
CCTGCGTAGAGGTCTCGCAACCCACCCGTTGGGTCTGGGCACCTAGCTTCCCGGCCTGCAAGGGCCTGTCCAAAGGCCGCCGCCGGATTCTGTGGACATC
ATCGAATGGAAACCCCACCGTATCTGCCGCCCAGCCCTTTGTGGGCCGCCTACGTGCCCTGGGCCTTGGTATTCGGCGGCTGGAGCTGCTCCTCAGCGCG
GGGGACTCGGGCACCTTTACTTGCAAGGGCCACGGAAAGGACGAGAGCCGTACTGTGCTTCGCGTGCTGGGGGACCCGGCAGATTGCAAGGCTCCGGAGC
CTACC-----------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
---------------------AGCCTGCTCTACGCAGACCTGGATCATAGGGCCCTCAGAAGTCCGCGCCGTCTGTCTCGGGTGGTCCCTGCTGAGGCCT
CCACCATCTATGCGGTTGTGGTTTGA


>BGISUSP0000884120
---------------------SLEGRPGDRVNLSCVEVSQPTRWVWAPSFPACKGLSKGRRRILWTSSNGNPTVSAAQPFVGRLRALGLGIRRLELLLSA
GDSGTFTCKGHGKDESRTVLRVLGDPADCKAPEPT-----------------------------------------------------------------
-------SLLYADLDHRALRSPRRLSRVVPAEASTIYAVVV*