Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000167279 (click for geneview)
Transcript ID ENST00000300681(link to ensembl)
Symbol NP_079167.1
Localtion Chromosome:11:117813393:117814237:1 band: 11q23.3
Description hypothetical protein FLJ11783
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--N--P--R--A--I--P--G--P--G--P--Y--T--A--S--H--S--P--F--L--H--L--H--P--L--P--P--P--Q--A--D--R--S--
ATGAACCCTCGCGCCATCCCCGGGCCAGGTCCCTATACTGCCAGCCACTCCCCCTTCCTTCACCTCCACCCTCTACCCCCACCCCAAGCAGACCGATCCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------><---><-----------------------------------------------
S--P--I--P--P--Y--P--T--G--E--N--L--S--S--A--P--A--W--P--I--L--G--L--G--R--G--G--G--S--Q--V--G--V--R
CCCCCATCCCGCCCTACCCCACCGGGGAAAATCTCTCCTCTGCACCTGCCTGGCCAATCCTGGGGCTTGGAAGGGGTGGGGGAAGCCAGGTTGGGGTGAG
                                                     ::::::::::::::::.::::: :::::::::: :::::::::::::
-----------------------------------------------------CCAATCCTGGGGCTTGAAAGGGCTGGGGGAAGCAAGGTTGGGGTGAG
------------------------------------------------------P--I--L--G--L--E--R--A--G--G--S--K--V--G--V--R

----------------------------------------------------------------------------------------------------
--R--V--D--K--G--Q--L--Y--F--S--V--V--A--V--V--A--L--G--W--E--K--K--D--Y--Q--A--K--L--F--L--R--K--D-
GAGAGTAGATAAGGGACAGTTATACTTTAGTGTGGTGGCGGTGGTTGCTTTGGGATGGGAGAAAAAGGATTATCAAGCAAAGTTATTCCTTAGAAAGGAC
::::::::::::::::::::: ::::::::::::::::.::.::.:::::. :: :::::::::...:.:::: ::::::::::::::::::: ::::: 
GAGAGTAGATAAGGGACAGTTTTACTTTAGTGTGGTGGTGGCGGCTGCTTCTGGTTGGGAGAAAGGAGGTTATGAAGCAAAGTTATTCCTTAG-AAGGAG
--R--V--D--K--G--Q--F--Y--F--S--V--V--V--A--A--A--S--G--W--E--K--G--G--Y--E--A--K--L--F--L--R--K--E-

----------------------------------------------------------------------------------------------------
----L--G--L--S--L--I--L--V--R--G--P-----K--V--D--E-----G--S--E--R--C--P-----F--P--I--S--T--G--A--R--
---TTGGGGTTGTCTCTGATTCTTGTAAGGGGACCC---AAGGTGGATGAA---GGGTCAGAGCGTTGCCCC---TTCCCCATTAGTACTGGGGCAAGAA
   ::.:::::.:. ::..  . ..:  ..::.      ::::::.:::::   :: ...:::: :::::::   :::::::::::::::::::::::::
CAGTTAGGGTTATTGCTAGGATGCATTTAAGGGGGACTCAAGGTGAATGAAA--GGTCTGGAGCTTTGCCCCC--TTCCCCATTAGTACTGGGGCAAGAA
-Q--L--G--L--L--L--G--C--I--*--G--G--L--K--V--N--E--\--G--L--E--L--C--P--\--F--P--I--S--T--G--A--R--

-----------------
T--E--L--L--L--*-
CGGAGTTGCTTCTATAA
.::.: :::::      
TGGGGATGCTT------
M--G--M--L-------

Pig Consensus Sequence

>BGISUST0000888465
----------------------------------------------------------------------------------------------------
-----------------------------------------------------CCAATCCTGGGGCTTGAAAGGGCTGGGGGAAGCAAGGTTGGGGTGAG
GAGAGTAGATAAGGGACAGTTTTACTTTAGTGTGGTGGTGGCGGCTGCTTCTGGTTGGGAGAAAGGAGGTTATGAAGCAAAGTTATTCCTtaAGGAGCAG
TTAGGGTTATTGCTAGGATGCATTTAAGGGGGACTCAAGGTgaTGAAAGGTCTGGAGCTtgCCCCCTTCCCCATTAGTACTGGGGCAAGAATGGGG----
--


>BGISUSP0000888465
---------------------------------------------------PILGLERAGGSKVGVRRVDKGQFYFSVVVAAASGWEKGGYEAKLFLKEQ
LGLLLGCI*GGLKVMKGLELAPFPISTGARMG--