Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000167418 (click for geneview)
Transcript ID ENST00000300884(link to ensembl)
Localtion Chromosome:16:33617382:33646870:-1 band: 16p11.2
Description  
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-I--D--E--P--T--S--P--S--T--D--L--Q--A--K--H--V--P--A--F--A--V--V--S--S--A--M--N--S--A--A--V--L--G--
ATAGATGAGCCCACCAGCCCCAGCACTGACCTCCAAGCCAAGCATGTCCCTGCCTTTGCTGTGGTCTCCAGTGCCATGAACTCAGCCGCTGTCCTGGGCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------------------><---------------------------------------
T--S--P--S--S--P--T--F--T--F--T--L--G--W--H--Y--S--R--D--C--S--S--I--K--A--G--R--R--S--S--Y--L--L--A
CCAGCCCATCTTCCCCGACCTTCACCTTCACCCTCGGATGGCATTACTCGCGGGACTGCAGCAGCATCAAGGCTGGCCGCCGCTCCTCCTACCTGCTGGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------------------------------><---------------------------
--I--S--T--E--R--S--K--S--C--D--D--G--L--N--T--F--R--D--E--G--Q--V--L--R--H--L--P--N--R--I--P--S--L-
CATCAGCACGGAGCGCTCCAAGTCCTGCGATGATGGACTCAACACCTTCCGTGACGAGGGCCAGGTTCTGCGGCACCTGCCAAACCGCATACCCAGCCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------><---------------------------------------------------------------------
-P--L--L--R--S--F--F--T--D--R--S--L--D--S--W--G--T--S--E--D--A--D--A--P--S--K--R--H--S--T--S--D--L--
CCGTTGCTCCGGAGCTTCTTCACAGACAGGTCCTTGGATAGCTGGGGCACCTCTGAAGACGCTGACGCTCCTTCTAAGCGACACTCAACCTCTGACCTCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------------------><-------------------------
S--D--A--T--F--S--N--I--R--R--E--G--W--L--Y--Y--K--Q--I--L--T--K--K--G--K--K--A--G--S--G--L--R--Q--W
CAGATGCGACCTTCAGCAATATCAGGAGAGAAGGCTGGTTGTATTATAAGCAGATTCTCACCAAGAAGGGGAAGAAAGCGGGCAGCGGCCTGCGCCAGTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------><----------------------------------------
--K--R--V--Y--A--A--L--L--A--R--S--L--S--L--S--K--E--Q--R--G--E--D--K--A--A--P--V--C--I--G--S--C--L-
GAAGCGGGTGTACGCCGCGCTGCTGGCGCGCTCGCTCTCGCTGAGCAAGGAGCAGCGGGGTGAGGACAAGGCGGCGCCCGTCTGCATCGGCTCCTGCCTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-V--D--I--Y--S--E--T--K--R--R--H--V--F--R--L--T--T--A--D--F--C--E--Y--L--F--Q--A--E--D--R--D--D--M--
GTGGACATCTACAGCGAGACCAAGAGGAGGCACGTGTTCCGGCTGACCACCGCTGACTTCTGTGAATATCTCTTTCAGGCTGAGGACCGGGATGACATGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----><-------------------------------------><-------------------------------------------------------
L--G--I--R--A--I--W--E--N--S--R--A--E--G--E--D--P--G--C--A--N--Q--A--L--I--S--K--K--L--N--D--Y--R--K
TGGGGATCAGAGCGATCTGGGAGAACAGCAGGGCCGAGGGCGAGGACCCCGGCTGTGCCAACCAAGCTCTGATCAGCAAGAAGCTTAATGATTATCGCAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----><---------------------------------------------------------------------------------------------
--V--S--H--S--S--G--P--K--A--D--S--S--P--K--G--S--R--G--L--G--G--L--K--S--E--F--L--K--Q--S--A--A--R-
AGTGAGCCATAGCTCTGGGCCCAAAGCTGATTCCTCCCCCAAAGGCTCTCGCGGCCTGGGGGGCCTCAAGTCTGAGTTCCTCAAGCAGAGTGCGGCACGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------><--------------------------------------------------------------
-G--L--R--T--Q--D--L--P--A--G--S--K--D--D--S--A--A--A--P--K--T--P--W--G--I--N--I--I--K--K--N--K--K--
GGCCTCAGGACTCAGGACCTGCCCGCAGGGAGCAAAGATGACAGTGCTGCAGCCCCCAAAACCCCCTGGGGCATCAACATCATCAAGAAAAATAAGAAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------><----------------------------------------
A--A--P--R--A--F--G--V--R--L--E--E--C--Q--P--A--T--E--N--Q--H--V--P--L--I--V--A--A--C--C--H--I--V--E
CTGCCCCAAGGGCATTTGGGGTCAGGCTGGAGGAGTGCCAGCCAGCCACGGAGAACCAGCATGTCCCCTTAATCGTGGCTGCATGCTGTCACATTGTGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--A--R--G--L--E--S--T--G--F--Y--R--V--P--G--N--N--A--V--V--S--S--L--Q--E--Q--L--N--P--G--P--G--D--I-
GGCACGAGGGCTGGAGTCCACAGGCTTTTACCGAGTGCCTGGCAACAATGCAGTGGTGTCCAGCCTACAGGAGCAGCTCAATCCTGGGCCTGGTGACATC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------><-----------------------------------------------------------------------------><-----
-N--Q--Q--D--E--R--W--Q--D--L--N--V--I--N--S--L--L--K--S--F--F--R--K--L--L--E--P--L--F--T--A--D--K--
AACCAGCAGGATGAGCGCTGGCAAGACCTCAATGTGATCAACAGCCTGCTCAAGTCCTTCTTCCGAAAGCTGCTCGAGCCTCTTTTCACTGCTGACAAAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------------><-------------------------------
Y--N--D--F--I--E--A--N--C--I--E--D--A--R--E--R--M--R--T--L--R--K--L--I--R--D--L--P--G--H--Y--Y--E--T
ACAACGACTTCATCGAGGCCAACTGCATTGAGGACGCGCGGGAGCGGATGAGGACGCTGCGGAAGCTGATCCGGGATCTCCCAGGACACTACTATGAAAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------------><-----------------------------------------
--L--K--F--L--V--G--H--L--K--T--I--A--D--H--S--E--K--N--K--M--E--L--W--N--L--A--L--V--F--G--R--T--L-
ACTCAAATTCCTTGTGGGCCATCTCAAGACCATCGCTGACCACTCTGAGAAAAACAAGATGGAACTCTGGAACCTGGCCCTGGTCTTTGGGCGGACACTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------------------------------------------><---------------
-V--R--T--S--E--G--N--M--T--D--M--V--T--H--M--P--D--R--Y--K--I--V--E--T--L--I--Q--H--S--D--W--F--F--
GTGAGGACGTCTGAGGGCAACATGACAGACATGGTGACCCACATGCCTGACCGCTACAAGATCGTGGAGACACTGATCCAGCACTCAGACTGGTTCTTCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------><-----------------------------------------------------------------------
S--D--K--E--D--K--G--E--R--D--P--A--S--E--G--M--P--V--D--P--S--S--C--S--Q--T--P--V--G--S--K--E--P--Q
GTGACAAAGAGGACAAGGGAGAGAGAGACCCAGCATCCGAGGGCATGCCAGTTGACCCCTCCTCCTGTTCGCAGACCCCTGTGGGCAGCAAGGAGCCTCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------->
--A--V--P--N--I--E--Y--L--L--P--N--I--G--R--T--V--P--P--G--D--P--G--S--G--E-
GGCAGTGCCCAACATTGAGTACCTCCTGCCCAACATTGGCAGGACAGTGCCCCCTGGTGACCCGGGGTCAGGTGAG
                                                                            
----------------------------------------------------------------------------
----------------------------------------------------------------------------