Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000170222 (click for geneview)
Transcript ID ENST00000303175(link to ensembl)
Symbol NP_064618.2
Localtion Chromosome:17:10541658:10555273:1 band: 17p13.1
Description x 006 protein
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--D--D--K--P--N--P--E--A--L--S--D--S--S--E--R--L--F--S--F--G--V--I--A--D--V--Q--F--A--D--L--E--D--
ATGGATGATAAACCCAATCCTGAAGCCCTAAGTGACAGTTCAGAGCGTCTTTTCTCCTTTGGCGTCATCGCAGATGTTCAATTTGCAGACTTAGAAGATG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
G--F--N--F--Q--G--T--R--R--R--Y--Y--R--H--S--L--L--H--L--Q--G--A--I--E--D--W--N--N--E--S--S--M--P--C
GCTTTAATTTCCAAGGAACCAGGCGGCGATACTACAGACATAGTCTTCTTCACTTACAGGGTGCCATTGAAGACTGGAATAATGAAAGCAGCATGCCCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--C--V--L--Q--L--G--D--I--I--D--G--Y--N--A--Q--Y--N--A--S--K--K--S--L--E--L--V--M--D--M--F--K--R--L-
TTGTGTCCTTCAGCTTGGAGATATCATCGATGGATATAATGCACAGTATAATGCATCCAAAAAGTCCCTAGAACTTGTTATGGACATGTTCAAGAGGCTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-K--V--P--V--H--H--T--W--G--N--H--E--F--Y--N--F--S--R--E--Y--L--T--H--S--K--L--N--T--K--F--L--E--D--
AAAGTTCCAGTTCATCATACATGGGGAAACCATGAATTCTATAACTTCAGTAGAGAGTATTTAACACACTCTAAACTTAACACTAAGTTTCTAGAAGATC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
Q--I--V--H--H--P--E--T--M--P--S--E--D--Y--Y--A--Y--H--F--V--P--F--P--K--F--R--F--I--L--L--D--A--Y--D
AGATTGTACATCATCCTGAGACCATGCCTTCAGAAGATTATTATGCTTATCATTTTGTACCATTCCCTAAATTCCGGTTCATTTTACTTGATGCATATGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--L--S--V--L--G--V--D--Q--S--S--P--K--Y--E--Q--C--M--K--I--L--R--E--H--N--P--N--T--E--L--N--S--P--Q-
CTTGAGTGTCTTGGGCGTGGATCAGTCTTCTCCAAAATACGAGCAGTGTATGAAGATATTGAGGGAGCACAATCCAAATACGGAACTGAATAGTCCTCAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------->
-G--E--L--F--L--*-
GGTGAATTATTCCTTTGA
                  
------------------
------------------