Sequences
EST Library Info
cbl5Blood
csp1Spleen - RNA from China
ese2Foetus 50 days, M. semitendinosus
fat1Fatt
hlv1Heart, left ventricle
jej1Small intestine, jejunum
lnt1Lymphatic nodule tracheobroncalis
med1Mediastinum
nlu1Newborn 115 days, lung
nms1Newborn 115 days, M. semitendinosus
pgl1Pituitary gland
pigcb2Unavailable
plac5Unavailable
plun1Unavailable
sme1M. Semimembranosus
Clusters
Oligos
SNPs

Gene ID ENSG00000168374 (click for geneview)
Transcript ID ENST00000303436(link to ensembl)
Symbol ARF4
Localtion Chromosome:3:57532134:57558154:-1 band: 3p14.3
Description ADP-ribosylation factor 4. [Source:Uniprot/SWISSPROT;Acc:P18085]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-----------------------------------------------------------------><--------------------------------
-M--G--L--T--I--S--S--L--F--S--R--L--F--G--K--K--Q--M--R--I--L--M--V--G--L--D--A--A--G--K--T--T--I--
ATGGGCCTCACTATCTCCTCCCTCTTCTCCCGACTATTTGGCAAGAAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACAACCATTC
:::::::::::.:::::::::::::::::::: :: ::.:::::::::::::::::::::::::::   :::::::::::::::::::::::.:::::::
ATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAGAAGCAGATGCGCATTTTGATG---GGATTGGATGCTGCTGGCAAGACGACCATTC
-M--G--L--T--I--S--S--L--F--S--R--L--F--G--K--K--Q--M--R--I--L--M-----G--L--D--A--A--G--K--T--T--I--

-----------------------------------------------><---------------------------------------------------
L--Y--K--L--K--L--G--E--I--V--T--T--I--P--T--I--G--F--N--V--E--T--V--E--Y--K--N--I--C--F--T--V--W--D
TGTATAAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACAGTAGAATATAAGAACATTTGTTTCACAGTATGGGA
:::::::::::::::::::::::::::::::::::::::::::::::   ::::::::::::::::::::::::::::::::::::::::::::::::::
TGTATAAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATT---TTTAATGTGGAAACAGTAGAATATAAGAACATTTGTTTCACAGTATGGGA
L--Y--K--L--K--L--G--E--I--V--T--T--I--P--T--I-----F--N--V--E--T--V--E--Y--K--N--I--C--F--T--V--W--D

---------------------------------------------------------><-----------------------------------------
--V--G--G--Q--D--R--I--R--P--L--W--K--H--Y--F--Q--N--T--Q--G--L--I--F--V--V--D--S--N--D--R--E--R--I-
TGTTGGTGGTCAAGATAGAATTAGGCCTCTCTGGAAGCATTACTTCCAGAATACCCAGGGTCTTATTTTTGTGGTAGATAGCAACGATCGTGAAAGAATT
:::::::::::::::::.:::::::::::::::::.::::::::::::.:::::::::                                          
TGTTGGTGGTCAAGATAAAATTAGGCCTCTCTGGAGGCATTACTTCCAAAATACCCAG------------------------------------------
--V--G--G--Q--D--K--I--R--P--L--W--R--H--Y--F--Q--N--T--Q-------------------------------------------

-----------------------------><---------------------------------------------------------------------
-Q--E--V--A--D--E--L--Q--K--M--L--L--V--D--E--L--R--D--A--V--L--L--L--F--A--N--K--Q--D--L--P--N--A--
CAGGAAGTAGCAGATGAGCTGCAGAAAATGCTTCTGGTAGATGAATTGAGAGATGCAGTGCTGCTACTTTTTGCAAACAAACAGGATTTGCCAAATGCTA
                                       :::::.::: .::::::::::.::::.::::::::::::::::::::::::::::::::::
---------------------------------------GATGAGTTGCAAGATGCAGTGTTGCTGCTTTTTGCAAACAAACAGGATTTGCCAAATGCTA
----------------------------------------D--E--L--Q--D--A--V--L--L--L--F--A--N--K--Q--D--L--P--N--A--

-------------------------------------------------------><-------------------------------------------
M--A--I--S--E--M--T--D--K--L--G--L--Q--S--L--R--N--R--T--W--Y--V--Q--A--T--C--A--T--Q--G--T--G--L--Y
TGGCCATCAGTGAAATGACAGATAAACTAGGGCTTCAGTCTCTTCGTAACAGAACATGGTATGTTCAAGCCACTTGTGCAACACAAGGAACTGGTCTGTA
:::::::.::.:::::::::::::::.:::: ::::::::::::::::::::::::::::::::::::::::::::::: ::::::::::::::::::::
TGGCCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAACATGGTATGTTCAAGCCACTTGTGCTACACAAGGAACTGGTCTGTA
M--A--I--S--E--M--T--D--K--L--G--L--Q--S--L--R--N--R--T--W--Y--V--Q--A--T--C--A--T--Q--G--T--G--L--Y

------------------------------------------>
--E--G--L--D--W--L--S--N--E--L--S--K--R--*-
TGAAGGACTTGACTGGCTGTCAAATGAGCTTTCAAAACGTTAA
:::.:::::::::::::::::::::::::::::::::::::::
TGAGGGACTTGACTGGCTGTCAAATGAGCTTTCAAAACGTTAA
--E--G--L--D--W--L--S--N--E--L--S--K--R--*-

Pig Consensus Sequence

>BGISUST0000895014
ATGGGCCTCACCATCTCCTCCCTCTTCTCCCGCCTCTTCGGCAAGAAGCAGATGCGCATTTTGATG---GGATTGGATGCTGCTGGCAAGACGACCATTC
TGTATAAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATT---TTTAATGTGGAAACAGTAGAATATAAGAACATTTGTTTCACAGTATGGGA
TGTTGGTGGTCAAGATAAAATTAGGCCTCTCTGGAGGCATTACTTCCAAAATACCCAG------------------------------------------
---------------------------------------GATGAGTTGCAAGATGCAGTGTTGCTGCTTTTTGCAAACAAACAGGATTTGCCAAATGCTA
TGGCCATTAGCGAAATGACAGATAAATTAGGTCTTCAGTCTCTTCGTAACAGAACATGGTATGTTCAAGCCACTTGTGCTACACAAGGAACTGGTCTGTA
TGAGGGACTTGACTGGCTGTCAAATGAGCTTTCAAAACGTTAA


>BGISUSP0000895014
MGLTISSLFSRLFGKKQMRILM-GLDAAGKTTILYKLKLGEIVTTIPTI-FNVETVEYKNICFTVWDVGGQDKIRPLWRHYFQNTQ--------------
-------------DELQDAVLLLFANKQDLPNAMAISEMTDKLGLQSLRNRTWYVQATCATQGTGLYEGLDWLSNELSKR*