Sequences
EST Library Info
uio4Unavailable
Clusters
Oligos
SNPs

Gene ID ENSG00000168679 (click for geneview)
Transcript ID ENST00000304624(link to ensembl)
Symbol SLC16A4
Localtion Chromosome:1:110617547:110645678:-1 band: 1p13.3
Description Monocarboxylate transporter 5 (MCT 5) (MCT 4). [Source:Uniprot/SWISSPROT;Acc:O15374]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-------------------------------------------------------------------------------------><------------
-M--L--K--R--E--G--K--V--Q--P--Y--T--K--T--L--D--G--G--W--G--W--M--I--V--I--H--F--F--L--V--N--V--F--
ATGCTGAAGAGGGAGGGGAAGGTCCAACCTTACACTAAAACCCTGGATGGAGGATGGGGATGGATGATTGTGATTCATTTTTTCCTGGTGAATGTGTTTG
                                                                                       :: ::::::::::
---------------------------------------------------------------------------------------GTCAATGTGTTTG
----------------------------------------------------------------------------------------V--N--V--F--

----------------------------------------------------------------------------------------------------
V--M--G--M--T--K--T--F--A--I--F--F--V--V--F--Q--E--E--F--E--G--T--S--E--Q--I--G--W--I--G--S--I--M--S
TGATGGGGATGACCAAGACTTTTGCAATTTTCTTTGTGGTCTTTCAAGAAGAGTTTGAAGGCACCTCAGAGCAAATTGGTTGGATTGGATCCATCATGTC
::::::::::::::::::::::::::::.:::::::::::.:::::::::::::::::::::::::: ::::::::::::::::::::::: ::::::::
TGATGGGGATGACCAAGACTTTTGCAATCTTCTTTGTGGTTTTTCAAGAAGAGTTTGAAGGCACCTCTGAGCAAATTGGTTGGATTGGATCAATCATGTC
V--M--G--M--T--K--T--F--A--I--F--F--V--V--F--Q--E--E--F--E--G--T--S--E--Q--I--G--W--I--G--S--I--M--S

-------------------><-------------------------------------------------------------------------------
--S--L--R--F--C--A--G--P--L--V--A--I--I--C--D--I--L--G--E--K--T--T--S--I--L--G--A--F--V--V--T--G--G-
ATCTCTTCGTTTTTGTGCAGGTCCCCTGGTTGCTATTATTTGTGACATACTTGGAGAGAAAACTACCTCCATTCTTGGGGCTTTCGTTGTTACTGGTGGA
.:: :::::::::: ::::   :::::.:.:::.:::::::..:::::: :::::: :::::::.:::: :::.: ::::::.:: :::: :::::::::
GTCACTTCGTTTTTCTGCA---CCCCTAGCTGCCATTATTTACGACATAATTGGAGCGAAAACTGCCTCAATTTTGGGGGCTCTCCTTGTGACTGGTGGA
--S--L--R--F--S--A-----P--L--A--A--I--I--Y--D--I--I--G--A--K--T--A--S--I--L--G--A--L--L--V--T--G--G-

---------------------------------------------------------------><-----------------------------------
-Y--L--I--S--S--W--A--T--S--I--P--F--L--C--V--T--M--G--L--L--P--G--L--G--S--A--F--L--Y--Q--V--A--A--
TATCTGATCAGCAGCTGGGCCACAAGTATTCCTTTTCTTTGTGTGACTATGGGACTTCTACCCGGTTTGGGTTCTGCTTTCTTATACCAAGTGGCTGCTG
:::::::::::::::..:::::::::.:::::.::.::.:::::::::::::::.::.::      :::::::::::::::::.::::::..::::.:::
TATCTGATCAGCAGCCAGGCCACAAGCATTCCCTTCCTCTGTGTGACTATGGGATTTTTA------TTGGGTTCTGCTTTCTTGTACCAAACGGCTACTG
-Y--L--I--S--S--Q--A--T--S--I--P--F--L--C--V--T--M--G--F--L--------L--G--S--A--F--L--Y--Q--T--A--T--

----------------------------------------------------------------------------------------------------
V--V--T--T--K--Y--F--K--K--R--L--A--L--S--T--A--I--A--R--S--G--M--G--L--T--F--L--L--A--P--F--T--K--F
TGGTAACTACCAAATACTTCAAAAAACGATTGGCTCTTTCTACAGCTATTGCCCGTTCTGGGATGGGACTGACTTTTCTTTTGGCACCCTTTACAAAATT
:::::::::: ::::::::::::::::::::.:::.:: ::::::: ::::::::::: :::::::::::::: :::.: ::.::::::::::::::: :
TGGTAACTACAAAATACTTCAAAAAACGATTAGCTTTTGCTACAGCGATTGCCCGTTCGGGGATGGGACTGACGTTTTTGTTAGCACCCTTTACAAAAGT
V--V--T--T--K--Y--F--K--K--R--L--A--F--A--T--A--I--A--R--S--G--M--G--L--T--F--L--L--A--P--F--T--K--V

-------------------------><-------------------------------------------------------------------------
--L--I--D--L--Y--D--W--T--G--A--L--I--L--F--G--A--I--A--L--N--L--V--P--S--S--M--L--L--R--P--I--H--I-
CCTGATAGATCTGTATGACTGGACAGGAGCCCTTATATTATTTGGAGCTATCGCATTGAATTTGGTGCCTTCTAGTATGCTCTTAAGACCCATCCATATC
:::: ::::::  ::::::::::::                                                                           
CCTGTTAGATCGCTATGACTGGACA---------------------------------------------------------------------------
--L--L--D--R--Y--D--W--T----------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-K--S--E--N--N--S--G--I--K--D--K--G--S--S--L--S--A--H--G--P--E--A--H--A--T--E--T--H--C--H--E--T--E--
AAAAGTGAGAACAATTCTGGTATTAAAGATAAAGGCAGCAGTTTGTCTGCACATGGTCCAGAGGCACATGCAACAGAAACACACTGCCATGAGACAGAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
E--S--T--I--K--D--S--T--T--Q--K--A--G--L--P--S--K--N--L--T--V--S--Q--N--Q--S--E--E--F--Y--N--G--P--N
AGTCTACCATCAAGGACAGTACTACGCAGAAGGCTGGACTACCTAGCAAAAATTTAACAGTCTCACAAAATCAAAGTGAAGAGTTCTACAATGGGCCTAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--R--N--R--L--L--L--K--S--D--E--E--S--D--K--V--I--S--W--S--C--K--Q--L--F--D--I--S--L--F--R--N--P--F-
CAGGAACAGACTGTTATTAAAGAGTGATGAAGAAAGTGATAAGGTTATTTCGTGGAGCTGCAAACAACTGTTTGACATTTCTCTCTTTAGAAATCCTTTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-F--Y--I--F--T--W--S--F--L--L--S--Q--L--A--Y--F--I--P--T--F--H--L--V--A--R--A--K--T--L--G--I--D--I--
TTCTACATATTTACTTGGTCTTTTCTCCTCAGTCAGTTAGCATACTTCATCCCTACCTTTCACCTGGTAGCCAGAGCCAAAACACTGGGGATTGACATCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------><---------------------------------------------------------------------
M--D--A--S--Y--L--V--S--V--A--G--I--L--E--T--V--S--Q--I--I--S--G--W--V--A--D--Q--N--W--I--K--K--Y--H
TGGATGCCTCTTACCTTGTTTCTGTAGCAGGTATCCTTGAGACGGTCAGTCAGATTATTTCTGGATGGGTTGCTGATCAAAACTGGATTAAGAAGTATCA
                                ::: ::::: :.:::.::::: ::.:.:::::::::::::::::::::::::::::..  ::::::::
--------------------------------ATCATTGAGTCAGTCGGTCAGCTTGTCTCTGGATGGGTTGCTGATCAAAACTGGATCGCCAAGTATCA
---------------------------------I--I--E--S--V--G--Q--L--V--S--G--W--V--A--D--Q--N--W--I--A--K--Y--H

----------------------------------------------------------------------------------------------------
--Y--H--K--S--Y--L--I--L--C--G--I--T--N--L--L--A--P--L--A--T--T--F--P--L--L--M--T--Y--T--I--C--F--A-
TTACCACAAGTCTTACCTCATCCTCTGCGGCATCACTAACCTGCTTGCTCCTTTAGCCACCACATTTCCACTACTTATGACCTACACCATCTGCTTTGCC
:::::::::::::::::::::::::::::::::::.::::::::::::::::::::::::::::::::::::::::::::::::.::::::: :::::::
TTACCACAAGTCTTACCTCATCCTCTGCGGCATCATTAACCTGCTTGCTCCTTTAGCCACCACATTTCCACTACTTATGACCTATACCATCTTCTTTGCC
--Y--H--K--S--Y--L--I--L--C--G--I--I--N--L--L--A--P--L--A--T--T--F--P--L--L--M--T--Y--T--I--F--F--A-

-----------------------------------------><---------------------------------------------------------
-I--F--A--G--G--Y--L--A--L--I--L--P--V--L--V--D--L--C--R--N--S--T--V--N--R--F--L--G--L--A--S--F--F--
ATCTTTGCTGGTGGTTACCTGGCATTGATACTGCCTGTACTGGTTGATCTGTGTAGGAATTCTACAGTAAACAGGTTTTTGGGACTTGCCAGTTTCTTTG
::.::. :.::::::::::::::::::::::: ::::::::::::::::: : ..::::::.::..::: ::::.::: :::: .:::::  ::::::::
ATTTTCTCCGGTGGTTACCTGGCATTGATACTTCCTGTACTGGTTGATCTCTCCGGGAATTTTATGGTACACAGATTTGTGGGTTTTGCCTCTTTCTTTG
-I--F--S--G--G--Y--L--A--L--I--L--P--V--L--V--D--L--S--G--N--F--M--V--H--R--F--V--G--F--A--S--F--F--

-----------------------------------><---------------------------------------------------------------
A--G--M--A--V--L--S--G--P--P--I--A--G--W--L--Y--D--Y--T--Q--T--Y--N--G--S--F--Y--F--S--G--I--C--Y--L
CTGGGATGGCTGTCCTTTCTGGACCACCTATAGCAGGCTGGTTATATGATTATACCCAGACATACAATGGCTCTTTCTACTTCTCTGGCATATGCTATCT
:::::::::::::.::::::::::::::: :.:::   ::::::.::::::::::::::::::::: ::::::.::::::.:::: :::..:::::::::
CTGGGATGGCTGTTCTTTCTGGACCACCTCTGGCA---TGGTTACATGATTATACCCAGACATACACTGGCTCCTTCTACCTCTCGGGCGCATGCTATCT
A--G--M--A--V--L--S--G--P--P--L--A-----W--L--H--D--Y--T--Q--T--Y--T--G--S--F--Y--L--S--G--A--C--Y--L

--------------------------------------------------------------->
--L--S--S--V--S--F--F--F--V--P--L--A--E--R--W--K--N--S--L--T--*-
CCTCTCTTCAGTTTCCTTTTTTTTTGTACCATTGGCCGAAAGATGGAAAAACAGTCTGACCTGA
 ::::::::::: ::::::::.:::::.:::.::::.::. .:::::.::::            
ACTCTCTTCAGTGTCCTTTTTCTTTGTGCCACTGGCTGAGCAATGGAGAAAC------------
--L--S--S--V--S--F--F--F--V--P--L--A--E--Q--W--R--N-------------

Pig Consensus Sequence

>BGISUST0000885770
---------------------------------------------------------------------------------------GTCAATGTGTTTG
TGATGGGGATGACCAAGACTTTTGCAATCTTCTTTGTGGTTTTTCAAGAAGAGTTTGAAGGCACCTCTGAGCAAATTGGTTGGATTGGATCAATCATGTC
GTCACTTCGTTTTTCTGCA---CCCCTAGCTGCCATTATTTACGACATAATTGGAGCGAAAACTGCCTCAATTTTGGGGGCTCTCCTTGTGACTGGTGGA
TATCTGATCAGCAGCCAGGCCACAAGCATTCCCTTCCTCTGTGTGACTATGGGATTTTTA------TTGGGTTCTGCTTTCTTGTACCAAACGGCTACTG
TGGTAACTACAAAATACTTCAAAAAACGATTAGCTTTTGCTACAGCGATTGCCCGTTCGGGGATGGGACTGACGTTTTTGTTAGCACCCTTTACAAAAGT
CCTGTTAGATCGCTATGACTGGACA---------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
--------------------------------ATCATTGAGTCAGTCGGTCAGCTTGTCTCTGGATGGGTTGCTGATCAAAACTGGATCGCCAAGTATCA
TTACCACAAGTCTTACCTCATCCTCTGCGGCATCATTAACCTGCTTGCTCCTTTAGCCACCACATTTCCACTACTTATGACCTATACCATCTTCTTTGCC
ATTTTCTCCGGTGGTTACCTGGCATTGATACTTCCTGTACTGGTTGATCTCTCCGGGAATTTTATGGTACACAGATTTGTGGGTTTTGCCTCTTTCTTTG
CTGGGATGGCTGTTCTTTCTGGACCACCTCTGGCA---TGGTTACATGATTATACCCAGACATACACTGGCTCCTTCTACCTCTCGGGCGCATGCTATCT
ACTCTCTTCAGTGTCCTTTTTCTTTGTGCCACTGGCTGAGCAATGGAGAAAC------------


>BGISUSP0000885770
-----------------------------VNVFVMGMTKTFAIFFVVFQEEFEGTSEQIGWIGSIMSSLRFSA-PLAAIIYDIIGAKTASILGALLVTGG
YLISSQATSIPFLCVTMGFL--LGSAFLYQTATVVTTKYFKKRLAFATAIARSGMGLTFLLAPFTKVLLDRYDWT-------------------------
----------------------------------------------------------------------------------------------------
--------------------------------------------IIESVGQLVSGWVADQNWIAKYHYHKSYLILCGIINLLAPLATTFPLLMTYTIFFA
IFSGGYLALILPVLVDLSGNFMVHRFVGFASFFAGMAVLSGPPLA-WLHDYTQTYTGSFYLSGACYLLSSVSFFFVPLAEQWRN----