Sequences
EST Library Info
cje7Jejunum - RNA from China
jej1Small intestine, jejunum
nje2Newborn 115 days, jejunum
Clusters
Oligos
SNPs

Gene ID ENSG00000172016 (click for geneview)
Transcript ID ENST00000305165(link to ensembl)
Symbol PAP1_HUMAN
Localtion Chromosome:2:79295788:79298534:-1 band: 2p12
Description Pancreatitis-associated protein 1 precursor (Regenerating islet- derived protein 3 alpha).
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<--------------------------------------------------------------------------><-----------------------
-M--L--P--P--M--A--L--P--S--V--S--W--M--L--L--S--C--L--M--L--L--S--Q--V--Q--G--E--E--P--Q--R--E--L--
ATGCTGCCTCCCATGGCCCTGCCCAGTGTATCTTGGATGCTGCTTTCCTGCCTCATGCTGCTGTCTCAGGTTCAAGGTGAAGAACCCCAGAGGGAACTGC
                                                                              ::::: .::: .. .::  .::
------------------------------------------------------------------------------GAAGATTCCCCAGCAGACACGC
-------------------------------------------------------------------------------E--D--S--P--A--D--T--

----------------------------------------------------------------------------------------------><----
P--S--A--R--I--R--C--P--K--G--S--K--A--Y--G--S--H--C--Y--A--L--F--L--S--P--K--S--W--T--D--A--D--L--A
CCTCTGCACGGATCCGCTGTCCCAAAGGCTCCAAGGCCTATGGCTCCCACTGCTATGCCTTGTTTTTGTCACCAAAATCCTGGACAGATGCAGATCTGGC
:::::::::::::: :::::::::::::::::: :::::::: .:::.::::::::::::::::: :. :::: ::: ::::::..:.::::      ::
CCTCTGCACGGATCAGCTGTCCCAAAGGCTCCATGGCCTATGCTTCCTACTGCTATGCCTTGTTTATAACACCCAAAACCTGGATGGGTGCA------GC
P--S--A--R--I--S--C--P--K--G--S--M--A--Y--A--S--Y--C--Y--A--L--F--I--T--P--K--T--W--M--G--A--------A

----------------------------------------------------------------------------------------------------
--C--Q--K--R--P--S--G--N--L--V--S--V--L--S--G--A--E--G--S--F--V--S--S--L--V--K--S--I--G--N--S--Y--S-
CTGCCAGAAGCGGCCCTCTGGAAACCTGGTGTCTGTGCTCAGTGGGGCTGAGGGATCCTTCGTGTCCTCCCTGGTGAAGAGCATTGGTAACAGCTACTCA
:::::::::::::::::: ::: :::: :..:::::::::::::::::::::: :::::::::::::::::::.: ::::.:: :   :::. :. ::::
CTGCCAGAAGCGGCCCTCAGGACACCTCGCATCTGTGCTCAGTGGGGCTGAGGCATCCTTCGTGTCCTCCCTGATCAAGAACAATTTGAACGCCCTCTCA
--C--Q--K--R--P--S--G--H--L--A--S--V--L--S--G--A--E--A--S--F--V--S--S--L--I--K--N--N--L--N--A--L--S-

--------------------------------><------------------------------------------------------------------
-Y--V--W--I--G--L--H--D--P--T--Q--G--T--E--P--N--G--E--G--W--E--W--S--S--S--D--V--M--N--Y--F--A--W--
TACGTCTGGATTGGGCTCCATGACCCCACACAGGGCACCGAGCCCAATGGAGAAGGTTGGGAGTGGAGTAGCAGTGATGTGATGAATTACTTTGCATGGG
 :::::::::::::::::::.::::::      ::: . ::::::::::  :. :: :::::::::::::::  ::::::: : :::::: :::: ::::
GACGTCTGGATTGGGCTCCACGACCCC------GGCTTGGAGCCCAATGCTGGTGGATGGGAGTGGAGTAGCTCTGATGTGCTCAATTACGTTGCCTGGG
-D--V--W--I--G--L--H--D--P--------G--L--E--P--N--A--G--G--W--E--W--S--S--S--D--V--L--N--Y--V--A--W--

-----------------------------------------------------------><---------------------------------------
E--R--N--P--S--T--I--S--S--P--G--H--C--A--S--L--S--R--S--T--A--F--L--R--W--K--D--Y--N--C--N--V--R--L
AGAGAAATCCCTCCACCATCTCAAGCCCCGGCCACTGTGCGAGCCTGTCGAGAAGCACAGCATTTCTGAGGTGGAAAGATTATAACTGTAATGTGAGGTT
:::::::::::::::::: ::::                                       : :::::..::::.::::::::::::. ::::::. ::
AGAGAAATCCCTCCACCAGCTCA---------------------------------------TATCTGAAATGGAGAGATTATAACTGCTATGTGAATTT
E--R--N--P--S--T--S--S-----------------------------------------Y--L--K--W--R--D--Y--N--C--Y--V--N--L

--------------------------->
--P--Y--V--C--K--F--T--D--*-
ACCCTATGTCTGCAAGTTCACTGACTAG
::::::::::::::::::::  ::::::
ACCCTATGTCTGCAAGTTCAAGGACTAG
--P--Y--V--C--K--F--K--D--*-

Pig Consensus Sequence

>BGISUST0000889543
------------------------------------------------------------------------------GAAGATTCCCCAGCAGACACGC
CCTCTGCACGGATCAGCTGTCCCAAAGGCTCCATGGCCTATGCTTCCTACTGCTATGCCTTGTTTATAACACCCAAAACCTGGATGGGTGCA------GC
CTGCCAGAAGCGGCCCTCAGGACACCTCGCATCTGTGCTCAGTGGGGCTGAGGCATCCTTCGTGTCCTCCCTGATCAAGAACAATTTGAACGCCCTCTCA
GACGTCTGGATTGGGCTCCACGACCCC------GGCTTGGAGCCCAATGCTGGTGGATGGGAGTGGAGTAGCTCTGATGTGCTCAATTACGTTGCCTGGG
AGAGAAATCCCTCCACCAGCTCA---------------------------------------TATCTGAAATGGAGAGATTATAACTGCTATGTGAATTT
ACCCTATGTCTGCAAGTTCAAGGACTAG


>BGISUSP0000889543
--------------------------EDSPADTPSARISCPKGSMAYASYCYALFITPKTWMGA--ACQKRPSGHLASVLSGAEASFVSSLIKNNLNALS
DVWIGLHDP--GLEPNAGGWEWSSSDVLNYVAWERNPSTSS-------------YLKWRDYNCYVNLPYVCKFKD*