Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000170930 (click for geneview)
Transcript ID ENST00000305285(link to ensembl)
Symbol MORF4
Localtion Chromosome:4:174911817:174912524:-1 band: 4q34.1
Description Transcription factor-like protein MORF4 (Mortality factor 4) (Cellular senescence-related protein 1) (SEN1). [Source:Uniprot/SWISSPROT;Acc:Q9Y690]
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--R--W--A--A--P--G--K--K--T--S--G--L--Q--Q--K--N--I--E--V--K--T--K--K--N--K--Q--K--T--P--G--N--G--
ATGAGATGGGCTGCCCCAGGAAAGAAGACATCTGGTCTGCAACAGAAAAATATTGAAGTGAAAACAAAAAAGAACAAACAGAAAACACCTGGAAATGGAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
D--G--G--S--T--S--E--T--P--Q--P--P--R--K--K--R--A--Q--V--D--P--T--V--E--N--E--E--T--F--M--N--R--V--E
ATGGTGGCAGTACCAGTGAGACTCCCCAGCCTCCTCGAAAGAAAAGGGCCCAGGTAGATCCTACTGTTGAAAATGAGGAAACATTCATGAACAGAGTTGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--V--K--V--K--I--P--E--E--L--K--P--W--L--V--D--D--W--D--L--I--T--R--Q--K--Q--L--F--Y--L--P--A--E--K-
AGTTAAAGTAAAGATTCCTGAAGAGCTAAAACCATGGCTTGTTGATGACTGGGACTTAATTACCAGGCAAAAACAGCTCTTCTATCTTCCTGCCGAGAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-N--V--D--S--I--L--E--D--Y--A--N--Y--K--K--S--H--G--N--T--D--N--K--E--Y--A--V--N--E--V--V--A--G--I--
AATGTGGATTCCATTCTTGAGGACTATGCAAATTACAAGAAATCTCATGGAAACACAGATAATAAGGAGTATGCAGTTAATGAAGTTGTGGCAGGGATAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
K--E--Y--F--N--L--M--L--G--T--Q--L--L--N--K--F--E--R--P--Q--Y--A--E--I--L--A--D--C--P--D--A--P--M--S
AAGAATACTTCAACCTAATGTTGGGCACCCAGCTACTCAACAAATTTGAGAGACCACAGTATGCCGAAATTCTTGCAGATTGTCCCGATGCACCCATGTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--Q--V--Y--G--V--P--H--L--L--R--L--S--V--Q--I--G--A--M--L--A--Y--T--P--L--N--E--K--S--L--A--L--L--L-
CCAGGTGTATGGAGTGCCACATCTCCTGAGATTATCTGTACAAATTGGAGCAATGTTGGCCTATACACCTCTGAATGAGAAGAGCCTTGCTTTATTACTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-N--Y--L--H--D--F--L--K--Y--L--A--K--N--S--A--T--L--F--S--A--S--D--Y--E--V--A--L--P--E--Y--H--R--K--
AATTATCTTCACGATTTCCTAAAGTACCTGGCAAAGAATTCTGCAACTTTGTTTAGTGCCAGCGATTATGAAGTGGCTCTTCCTGAGTACCATCGGAAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------->
A--V--*-
CTGTGTGA
        
--------
--------