Sequences
EST Library Info
cga1Galactophore - RNA from China
cly1Lymph - RNA from China
dbla1Unavailable
ebs2Foetus 50 days, brain stem
eje1Foetus 50 days, jejunum
elu2Foetus 50 days, lung
eye1Foetus 50 days, Eye
fbs1Unavailable
hyp1Hypothalamus
jca2Joint capsule
jej1Small intestine, jejunum
lnt1Lymphatic nodule tracheobroncalis
nlu2Newborn 115 days, lung
pldo2Unavailable
relu1Unavailable
ton1Tip of tongue, mucosal membrane
Clusters
Oligos
SNPs

Gene ID ENSG00000170310 (click for geneview)
Transcript ID ENST00000306357(link to ensembl)
Symbol STX8
Localtion Chromosome:17:9094514:9420000:-1 band: 17p13.1
Description Syntaxin-8. [Source:Uniprot/SWISSPROT;Acc:Q9UNK0]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------><----------------------------------------------------------------------------------
-M--A--P--D--P--W--F--S--T--Y--D--S--T--C--Q--I--A--Q--E--I--A--E--K--I--Q--Q--R--N--Q--Y--E--R--K--
ATGGCACCGGACCCCTGGTTCTCCACATACGATTCTACTTGTCAAATTGCCCAAGAAATTGCTGAGAAAATTCAACAACGAAATCAATATGAAAGAAAAG
                  ::::::::.:::::::::::::::::.::::::::::::::.::::::::.:::::: ::::::::::.:.::::::::.::
------------------TTCTCCACGTACGATTCTACTTGTCAGATTGCCCAAGAAATCGCTGAGAAGATTCAAGAACGAAATCAGTGTGAAAGAAGAG
-------------------F--S--T--Y--D--S--T--C--Q--I--A--Q--E--I--A--E--K--I--Q--E--R--N--Q--C--E--R--R--

----------------><----------------------------------------------------------------------------------
G--E--K--A--P--K--L--T--V--T--I--R--A--L--L--Q--N--L--K--E--K--I--A--L--L--K--D--L--L--L--R--A--V--S
GTGAAAAGGCACCAAAGCTTACCGTGACAATCAGAGCTTTGTTGCAGAACCTGAAGGAAAAGATCGCCCTTTTGAAGGACTTATTGCTAAGAGCTGTGTC
::::.:::.:::: :::::::: :::::::::::::::: ::::::::: ::::::::::::::::::::::::::::::::::::::::::::::::::
GTGAGAAGACACCTAAGCTTACGGTGACAATCAGAGCTTGGTTGCAGAAACTGAAGGAAAAGATCGCCCTTTTGAAGGACTTATTGCTAAGAGCTGTGTC
G--E--K--T--P--K--L--T--V--T--I--R--A--W--L--Q--K--L--K--E--K--I--A--L--L--K--D--L--L--L--R--A--V--S

-----------><---------------------------------------------------------------------------------------
--T--H--Q--I--T--Q--L--E--G--D--R--R--Q--N--L--L--D--D--L--V--T--R--E--R--L--L--L--A--S--F--K--N--E-
AACACATCAGATAACACAGCTTGAAGGGGACCGAAGACAGAACCTCTTGGATGATCTTGTAACTCGAGAGAGACTACTTCTGGCATCCTTTAAGAATGAG
::::::::::   ::.:::::.:::::.::::::::::::::::: :::::.::::::::::::::::::::::: :::::::: ::::::::::: :::
AACACATCAG---ACGCAGCTCGAAGGAGACCGAAGACAGAACCTATTGGACGATCTTGTAACTCGAGAGAGACTCCTTCTGGCCTCCTTTAAGAAGGAG
--T--H--Q-----T--Q--L--E--G--D--R--R--Q--N--L--L--D--D--L--V--T--R--E--R--L--L--L--A--S--F--K--K--E-

----------------------><----------------------------------------------------------------------------
-G--A--E--P--D--L--I--R--S--S--L--M--S--E--E--A--K--R--G--A--P--N--P--W--L--F--E--E--P--E--E--T--R--
GGTGCCGAACCAGATCTAATCAGGTCCAGCCTGATGAGTGAAGAGGCTAAGCGAGGAGCACCCAACCCTTGGCTCTTTGAGGAGCCAGAGGAGACCAGAG
::.:: ::.::.:: :. :::   :::::::::::::  :.::.:::.:::::.: ::.::::::::::::::::::.::::::::.:::::::::::::
GGCGCAGAGCCGGAACCCATC---TCCAGCCTGATGACAGGAGGGGCCAAGCGGGCAGTACCCAACCCTTGGCTCTTCGAGGAGCCGGAGGAGACCAGAG
-G--A--E--P--E--P--I-----S--S--L--M--T--G--G--A--K--R--A--V--P--N--P--W--L--F--E--E--P--E--E--T--R--

-----------------------------------------------><---------------------------------------------------
G--L--G--F--D--E--I--R--Q--Q--Q--Q--K--I--I--Q--E--Q--D--A--G--L--D--A--L--S--S--I--I--S--R--Q--K--Q
GCTTGGGTTTTGATGAAATCCGGCAACAGCAGCAGAAAATTATCCAAGAACAGGACGCAGGCCTTGATGCCCTTTCCTCTATCATAAGTCGCCAAAAACA
:::::::.:::::.::::::::::::::::::::::::::.::::::   :::::.:::::::: :::::::::::::: ::::::::::::::.:::::
GCTTGGGCTTTGACGAAATCCGGCAACAGCAGCAGAAAATCATCCAA---CAGGATGCAGGCCTGGATGCCCTTTCCTCGATCATAAGTCGCCAGAAACA
G--L--G--F--D--E--I--R--Q--Q--Q--Q--K--I--I--Q-----Q--D--A--G--L--D--A--L--S--S--I--I--S--R--Q--K--Q

----------------------------------------><----------------------------------------------------------
--M--G--Q--E--I--G--N--E--L--D--E--Q--N--E--I--I--D--D--L--A--N--L--V--E--N--T--D--E--K--L--R--N--E-
AATGGGGCAGGAAATTGGGAATGAATTGGATGAACAAAATGAGATAATTGACGACCTTGCCAACCTAGTGGAGAACACAGATGAAAAACTTCGCAATGAA
:::::::::::::::::::::::::.:::::::::::                              :::::::::::::::::.::::: .::: ::::
AATGGGGCAGGAAATTGGGAATGAACTGGATGAACAA------------------------------GTGGAGAACACAGATGAGAAACTGTGCACTGAA
--M--G--Q--E--I--G--N--E--L--D--E--Q--------------------------------V--E--N--T--D--E--K--L--C--T--E-

------------------------------------------><--------------------------------------------------------
-T--R--R--V--N--M--V--D--R--K--S--A--S--C--G--M--I--M--V--I--L--L--L--L--V--A--I--V--V--V--A--V--W--
ACCAGGCGGGTAAACATGGTGGACAGAAAGTCAGCCTCTTGTGGGATGATCATGGTGATTTTACTGCTGCTTGTGGCTATCGTGGTTGTTGCAGTCTGGC
::::::.:  :.::..::.:.:::::.: :::: ::::::::   :::::  :::::::. :..:::::::.:::::.::::::::.:: ::::::::::
ACCAGGTGTTTGAATGTGATAGACAGGATGTCACCCTCTTGT---ATGATACTGGTGATCGTGTTGCTGCTCGTGGCCATCGTGGTCGTGGCAGTCTGGC
-T--R--C--L--N--V--I--D--R--M--S--P--S--C-----M--I--L--V--I--V--L--L--L--V--A--I--V--V--V--A--V--W--

---------->
P--T--N--*-
CGACCAACTGA
::::::::   
CGACCAAC---
P--T--N----

Pig Consensus Sequence

>BGISUST0000892307
------------------TTCTCCACGTACGATTCTACTTGTCAGATTGCCCAAGAAATCGCTGAGAAGATTCAAGAACGAAATCAGTGTGAAAGAAGAG
GTGAGAAGACACCTAAGCTTACGGTGACAATCAGAGCTTGGTTGCAGAAACTGAAGGAAAAGATCGCCCTTTTGAAGGACTTATTGCTAAGAGCTGTGTC
AACACATCAG---ACGCAGCTCGAAGGAGACCGAAGACAGAACCTATTGGACGATCTTGTAACTCGAGAGAGACTCCTTCTGGCCTCCTTTAAGAAGGAG
GGCGCAGAGCCGGAACCCATC---TCCAGCCTGATGACAGGAGGGGCCAAGCGGGCAGTACCCAACCCTTGGCTCTTCGAGGAGCCGGAGGAGACCAGAG
GCTTGGGCTTTGACGAAATCCGGCAACAGCAGCAGAAAATCATCCAA---CAGGATGCAGGCCTGGATGCCCTTTCCTCGATCATAAGTCGCCAGAAACA
AATGGGGCAGGAAATTGGGAATGAACTGGATGAACAA------------------------------GTGGAGAACACAGATGAGAAACTGTGCACTGAA
ACCAGGTGTTTGAATGTGATAGACAGGATGTCACCCTCTTGT---ATGATACTGGTGATCGTGTTGCTGCTCGTGGCCATCGTGGTCGTGGCAGTCTGGC
CGACCAAC---


>BGISUSP0000892307
------FSTYDSTCQIAQEIAEKIQERNQCERRGEKTPKLTVTIRAWLQKLKEKIALLKDLLLRAVSTHQ-TQLEGDRRQNLLDDLVTRERLLLASFKKE
GAEPEPI-SSLMTGGAKRAVPNPWLFEEPEETRGLGFDEIRQQQQKIIQ-QDAGLDALSSIISRQKQMGQEIGNELDEQ----------VENTDEKLCTE
TRCLNVIDRMSPSC-MILVIVLLLVAIVVVAVWPTN-