Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000189180 (click for geneview)
Transcript ID ENST00000307441(link to ensembl)
Symbol ZNF33A
Localtion Chromosome:10:38345796:38388300:1 band: 10p11.21
Description Zinc finger protein 33A (Zinc finger protein KOX31) (HA0946). [Source:Uniprot/SWISSPROT;Acc:Q06730]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--F--Q--V--E--Q--K--S--Q--E--S--V--S--F--K--D--V--T--V--G--F--T--Q--E--E--W--Q--H--L--D--P--S--Q--
ATGTTTCAGGTAGAACAGAAGTCCCAGGAGTCAGTATCATTTAAAGATGTGACTGTGGGCTTCACCCAGGAGGAGTGGCAGCACCTGGACCCTAGTCAGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------------><---------------------------------------------
R--A--L--Y--R--D--V--M--L--E--N--Y--S--N--L--V--S--V--G--Y--C--V--H--K--P--E--V--I--F--R--L--Q--Q--G
GGGCTCTGTATAGAGATGTGATGCTGGAGAACTACAGCAACCTTGTCTCAGTGGGGTATTGTGTTCACAAACCAGAGGTGATCTTCAGGCTGCAACAAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------><-------------------------------------------------
--E--E--P--W--K--Q--E--E--E--F--P--S--Q--S--F--P--V--W--T--A--D--H--L--K--E--R--S--Q--E--N--Q--S--K-
AGAAGAGCCATGGAAACAGGAGGAAGAATTCCCAAGCCAAAGCTTTCCAGTCTGGACAGCTGATCACCTGAAAGAGAGGAGCCAAGAAAACCAATCTAAA
                                                    :::: :. ::::::: :.::::: :::::::::::::::::.::::::
----------------------------------------------------TGGAAAAATGATCACATAAAAGACAGGAGCCAAGAAAACCAGTCTAAA
-----------------------------------------------------W--K--N--D--H--I--K--D--R--S--Q--E--N--Q--S--K-

----------------------------------------------------------------------------------------------------
-H--L--W--E--V--V--F--I--N--N--E--M--L--T--K--E--Q--G--D--V--I--G--I--P--F--N--V--D--V--S--S--F--P--
CATTTGTGGGAAGTTGTATTCATCAATAATGAAATGCTGACTAAGGAACAAGGTGATGTAATAGGAATACCATTTAATGTGGATGTAAGTTCTTTTCCTT
::: :::::::::::::::::::::.:::..:::::::.:::.:.:::::::::.:.:::::::::: :::::: ::: ::::...:..::: :::::: 
CATGTGTGGGAAGTTGTATTCATCAGTAACAAAATGCTAACTGAAGAACAAGGTAACGTAATAGGAAAACCATTGAATTTGGACACAGATTCATTTCCTA
-H--V--W--E--V--V--F--I--S--N--K--M--L--T--E--E--Q--G--N--V--I--G--K--P--L--N--L--D--T--D--S--F--P--

----------------------------------------------------------------------------------------------------
S--R--K--M--F--C--Q--C--D--S--C--G--M--S--F--N--T--V--S--E--L--V--I--S--K--I--N--Y--L--G--K--K--S--D
CCAGAAAAATGTTCTGTCAGTGTGATTCATGTGGAATGAGTTTCAACACTGTTTCAGAATTGGTTATCAGTAAGATAAACTATTTAGGAAAAAAGTCTGA
 :::::::::..:::::::::::::.:::::::.::::::.::::::  : :::::::::: :::::::.::::: :::::::::.              
ACAGAAAAATACTCTGTCAGTGTGACTCATGTGAAATGAGCTTCAACTGTCTTTCAGAATTTGTTATCAATAAGAAAAACTATTTG--------------
N--R--K--I--L--C--Q--C--D--S--C--E--M--S--F--N--C--L--S--E--F--V--I--N--K--K--N--Y--L---------------

----------------------------------------------------------------------------------------------------
--E--F--N--A--C--G--K--L--L--L--N--I--K--H--D--E--T--H--T--Q--E--K--N--E--V--L--K--N--R--N--T--L--S-
TGAATTTAATGCCTGTGGGAAATTGTTACTCAATATTAAGCATGATGAAACTCATACTCAAGAGAAAAATGAAGTTTTGAAAAATAGGAACACACTGAGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-H--H--E--E--T--L--Q--H--E--K--I--Q--T--L--E--H--N--F--E--Y--S--I--C--Q--E--T--L--L--E--K--A--V--F--
CATCATGAGGAGACTTTGCAGCATGAGAAGATTCAAACTTTAGAGCACAATTTTGAATACAGTATATGTCAGGAAACCCTCCTTGAAAAGGCAGTATTCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
N--T--Q--K--R--E--N--A--E--E--N--N--C--D--Y--N--E--F--G--R--T--L--C--D--S--S--S--L--L--F--H--Q--I--S
ATACACAGAAGAGAGAGAACGCAGAAGAGAATAACTGTGATTATAATGAATTTGGGAGAACTTTGTGTGATAGTTCATCCCTCTTGTTCCATCAGATATC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--P--S--R--D--N--H--Y--E--F--S--D--C--E--K--F--L--C--V--K--S--T--L--S--K--P--H--G--V--S--M--K--H--Y-
TCCGTCAAGGGACAATCACTATGAATTTAGTGATTGTGAGAAGTTCTTATGTGTGAAGTCCACCCTTTCTAAACCTCATGGGGTATCTATGAAACACTAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-D--C--G--E--S--G--N--N--F--R--R--K--L--C--L--S--H--L--Q--K--G--D--K--G--E--K--H--F--E--C--N--E--C--
GATTGTGGTGAAAGTGGGAATAATTTCAGGAGGAAATTGTGTCTGTCACACCTTCAGAAAGGTGATAAAGGAGAGAAACACTTTGAATGTAATGAATGTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
G--K--A--F--W--E--K--S--H--L--T--R--H--Q--R--V--H--T--G--Q--K--P--F--Q--C--N--E--C--E--K--A--F--W--D
GGAAAGCTTTCTGGGAGAAGTCACATCTCACTCGACATCAGAGGGTGCACACAGGACAGAAACCCTTTCAATGTAATGAATGTGAAAAAGCTTTCTGGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--K--S--N--L--T--K--H--Q--R--S--H--T--G--E--K--P--F--E--C--N--E--C--G--K--A--F--S--H--K--S--A--L--T-
TAAGTCAAACCTCACTAAACATCAAAGATCACACACAGGGGAGAAACCTTTTGAATGCAATGAATGTGGGAAAGCCTTTAGCCATAAGTCAGCCCTCACA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-L--H--Q--R--T--H--T--G--E--K--P--Y--Q--C--N--A--C--G--K--T--F--C--Q--K--S--D--L--T--K--H--Q--R--T--
TTACACCAGAGAACACATACAGGGGAGAAACCCTATCAATGTAATGCGTGTGGGAAAACTTTTTGCCAGAAATCTGACCTCACTAAACATCAGAGAACAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
H--T--G--L--K--P--Y--E--C--Y--E--C--G--K--S--F--R--V--T--S--H--L--K--V--H--Q--R--T--H--T--G--E--K--P
ACACAGGGCTGAAACCCTATGAATGTTATGAATGTGGAAAATCCTTCCGTGTGACTTCGCACCTTAAAGTACACCAGAGAACTCACACAGGTGAGAAACC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--F--E--C--L--E--C--G--K--S--F--S--E--K--S--N--L--T--Q--H--Q--R--I--H--I--G--D--K--S--Y--E--C--N--A-
TTTTGAATGTCTTGAGTGTGGGAAATCCTTTAGTGAAAAGTCAAATCTTACACAGCATCAGAGAATTCACATAGGAGATAAATCTTATGAATGTAATGCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-C--G--K--T--F--Y--H--K--S--L--L--T--R--H--Q--I--I--H--T--G--W--K--P--Y--E--C--Y--E--C--G--K--T--F--
TGTGGGAAAACTTTCTACCACAAGTCATTACTCACCAGGCATCAGATAATTCATACAGGGTGGAAACCTTATGAATGTTATGAATGTGGGAAAACCTTCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
C--L--K--S--D--L--T--V--H--Q--R--T--H--T--G--Q--K--P--F--A--C--P--E--C--G--K--F--F--S--H--K--S--T--L
GCTTGAAGTCAGACCTCACAGTACATCAGAGAACACACACAGGGCAGAAACCCTTTGCATGTCCCGAATGTGGGAAATTCTTTAGCCATAAGTCAACCCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--S--Q--H--Y--R--T--H--T--G--E--K--P--Y--E--C--H--E--C--G--K--I--F--Y--N--K--S--Y--L--T--K--H--N--R-
CTCTCAACATTATAGAACACACACAGGGGAGAAACCCTACGAATGTCATGAATGTGGAAAAATCTTTTACAATAAATCATACCTAACTAAACATAATAGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-T--H--T--G--E--K--P--Y--E--C--N--E--C--G--K--A--F--Y--Q--K--S--Q--L--T--Q--H--Q--R--I--H--I--G--E--
ACACATACAGGGGAGAAACCCTATGAATGTAATGAATGTGGAAAAGCCTTCTACCAGAAGTCACAACTCACTCAGCATCAGAGAATTCACATAGGGGAGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
K--P--Y--K--C--N--E--C--G--K--A--F--C--H--K--S--A--L--I--V--H--Q--R--T--H--T--Q--E--K--P--Y--K--C--N
AACCCTATAAATGTAATGAGTGTGGAAAAGCTTTCTGCCATAAGTCAGCTCTAATTGTACATCAGAGAACCCATACACAAGAAAAGCCCTATAAATGTAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--E--C--G--K--S--F--C--V--K--S--G--L--I--F--H--E--R--K--H--T--G--E--K--P--Y--E--C--N--E--C--G--K--F-
TGAATGTGGAAAATCTTTCTGTGTAAAATCAGGACTTATTTTCCATGAGAGAAAGCACACGGGGGAGAAACCCTATGAATGCAATGAATGTGGGAAATTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-F--R--H--K--S--S--L--T--V--H--H--R--A--H--T--G--E--K--S--C--Q--C--N--E--C--G--K--I--F--Y--R--K--S--
TTCAGGCACAAATCATCACTCACAGTACATCACAGGGCTCACACAGGAGAGAAATCTTGTCAATGTAATGAATGTGGAAAAATCTTTTACCGTAAATCGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
E--L--A--Q--H--Q--R--S--H--T--G--E--K--P--Y--E--C--N--T--C--R--K--T--F--S--Q--K--S--N--L--I--V--H--Q
AACTTGCTCAACATCAGAGATCACATACAGGGGAAAAGCCCTATGAATGTAACACATGCAGGAAAACTTTCTCTCAAAAGTCAAATCTCATTGTACATCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--R--R--H--I--G--E--N--L--M--N--E--M--D--I--R--N--F--Q--P--Q--V--S--L--H--N--A--S--E--Y--S--H--C--G-
GAGAAGACATATAGGAGAAAACCTTATGAATGAAATGGATATTAGAAATTTCCAGCCACAAGTCAGCCTCCATAATGCCTCAGAGTATTCACACTGTGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------->
-E--S--P--D--D--I--L--N--V--Q--*-
GAAAGCCCTGATGACATCCTGAATGTTCAGTAA
                                 
---------------------------------
---------------------------------

Pig Consensus Sequence

>BGISUST0000893489
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------TGGAAAAATGATCACATAAAAGACAGGAGCCAAGAAAACCAGTCTAAA
CATGTGTGGGAAGTTGTATTCATCAGTAACAAAATGCTAACTGAAGAACAAGGTAACGTAATAGGAAAACCATTGAATTTGGACACAGATTCATTTCCTA
ACAGAAAAATACTCTGTCAGTGTGACTCATGTGAAATGAGCTTCAACTGTCTTTCAGAATTTGTTATCAATAAGAAAAACTATTTG--------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
---------------------------------


>BGISUSP0000893489
------------------------------------------------------------------------------------WKNDHIKDRSQENQSK
HVWEVVFISNKMLTEEQGNVIGKPLNLDTDSFPNRKILCQCDSCEMSFNCLSEFVINKKNYL--------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
-----------