Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000174339 (click for geneview)
Transcript ID ENST00000307832(link to ensembl)
Symbol OR2Y1
Localtion Chromosome:5:180098729:180099664:-1 band: 5q35.3
Description Olfactory receptor 2Y1. [Source:Uniprot/SWISSPROT;Acc:Q8NGV0]
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--G--S--F--N--T--S--F--E--D--G--F--I--L--V--G--F--S--D--W--P--Q--L--E--P--I--L--F--V--F--I--F--I--
ATGGGAAGTTTCAACACCAGTTTTGAAGATGGCTTCATTTTGGTGGGATTCTCAGATTGGCCGCAACTGGAGCCCATCCTGTTTGTCTTTATTTTTATTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
F--Y--S--L--T--L--F--G--N--T--I--I--I--A--L--S--W--L--D--L--R--L--H--T--P--M--Y--F--F--L--S--H--L--S
TCTACTCCCTAACTCTCTTTGGCAACACCATCATCATCGCTCTCTCCTGGCTAGACCTTCGGCTGCACACACCTATGTACTTCTTTCTCTCTCATCTGTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--L--L--D--L--C--F--T--T--S--T--V--P--Q--L--L--I--N--L--C--G--V--D--R--T--I--T--R--G--G--C--V--A--Q-
CCTCCTGGACCTCTGCTTCACCACCAGCACCGTGCCCCAGCTCCTGATCAACCTTTGCGGGGTGGACCGCACCATCACCCGTGGAGGGTGTGTGGCTCAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-L--F--I--Y--L--A--L--G--S--T--E--C--V--L--L--V--V--M--A--F--D--R--Y--A--A--V--C--R--P--L--H--Y--M--
CTCTTCATCTACCTAGCCCTGGGCTCCACAGAGTGTGTGCTCCTGGTGGTGATGGCCTTTGACCGCTATGCTGCTGTCTGTCGTCCACTCCACTACATGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
A--I--M--H--P--H--L--C--Q--T--L--A--I--A--S--W--G--A--G--F--V--N--S--L--I--Q--T--G--L--A--M--A--M--P
CCATCATGCACCCCCATCTCTGCCAGACCCTGGCTATCGCCTCCTGGGGTGCGGGTTTCGTGAACTCTCTGATCCAGACAGGTCTCGCAATGGCCATGCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--L--C--G--H--R--L--N--H--F--F--C--E--M--P--V--F--L--K--L--A--C--A--D--T--E--G--T--E--A--K--M--F--V-
TCTCTGTGGCCATCGACTGAATCACTTCTTCTGTGAGATGCCTGTATTTCTGAAGTTGGCTTGTGCGGACACAGAAGGAACAGAGGCCAAGATGTTTGTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-A--R--V--I--V--V--A--V--P--A--A--L--I--L--G--S--Y--V--H--I--A--H--A--V--L--R--V--K--S--T--A--G--R--
GCCCGAGTCATAGTCGTGGCTGTTCCTGCAGCACTTATTCTAGGCTCCTATGTGCACATTGCTCATGCAGTGCTGAGGGTGAAGTCAACGGCTGGGCGCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
R--K--A--F--G--T--C--G--S--H--L--L--V--V--F--L--F--Y--G--S--A--I--Y--T--Y--L--Q--S--I--H--N--Y--S--E
GAAAGGCTTTTGGGACTTGTGGGTCCCACCTCCTAGTAGTTTTCCTTTTTTATGGCTCAGCCATCTACACATATCTCCAATCCATCCACAATTATTCTGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--R--E--G--K--F--V--A--L--F--Y--T--I--I--T--P--I--L--N--P--L--I--Y--T--L--R--N--K--D--V--K--G--A--L-
GCGTGAGGGAAAATTTGTTGCCCTTTTTTATACTATAATTACCCCCATTCTCAATCCTCTCATTTATACACTAAGAAACAAGGACGTGAAGGGGGCTCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------->
-W--K--V--L--W--R--G--R--D--S--G--*-
TGGAAAGTACTATGGAGGGGCAGGGACTCAGGGTAG
                                    
------------------------------------
------------------------------------