Sequences
EST Library Info
eru3Foetus 50 days, regio umbilicalis
spl2Spleen
Clusters
Oligos
SNPs

Gene ID ENSG00000138594 (click for geneview)
Transcript ID ENST00000308580(link to ensembl)
Symbol TMOD3
Localtion Chromosome:15:49909155:49989136:1 band: 15q21.2
Description Tropomodulin-3 (Ubiquitous tropomodulin) (U-Tmod). [Source:Uniprot/SWISSPROT;Acc:Q9NYL9]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--A--L--P--F--R--K--D--L--E--K--Y--K--D--L--D--E--D--E--L--L--G--N--L--S--E--T--E--L--K--Q--L--E--
ATGGCACTGCCATTCCGTAAGGACTTAGAAAAGTACAAAGACCTTGATGAAGATGAGCTCCTTGGGAATCTGTCAGAAACAGAACTGAAACAACTGGAAA
::::::::..::::::: ::::::::::::::::::::.:::::.:::::::::::.::::::::::::::.::::::..:::.:::::::::::.::::
ATGGCACTATCATTCCGGAAGGACTTAGAAAAGTACAAGGACCTCGATGAAGATGAACTCCTTGGGAATCTATCAGAAGTAGAGCTGAAACAACTAGAAA
-M--A--L--S--F--R--K--D--L--E--K--Y--K--D--L--D--E--D--E--L--L--G--N--L--S--E--V--E--L--K--Q--L--E--

-------------------------><-------------------------------------------------------------------------
T--V--L--D--D--L--D--P--E--N--A--L--L--P--A--G--F--R--Q--K--N--Q--T--S--K--S--T--T--G--P--F--D--R--E
CTGTTTTGGATGATCTTGACCCCGAGAATGCCCTTCTGCCTGCAGGGTTCCGGCAGAAGAACCAGACATCAAAGTCCACCACAGGGCCATTTGATAGAGA
:::::.::::::::::::::::.:::::::::::::::::::::::.:::::::::::::::::::::::::::::..:::::::::::::.::::::::
CTGTTCTGGATGATCTTGACCCTGAGAATGCCCTTCTGCCTGCAGGATTCCGGCAGAAGAACCAGACATCAAAGTCTGCCACAGGGCCATTCGATAGAGA
T--V--L--D--D--L--D--P--E--N--A--L--L--P--A--G--F--R--Q--K--N--Q--T--S--K--S--A--T--G--P--F--D--R--E

----------------------------------------------------------------------------------><----------------
--H--L--L--S--Y--L--E--K--E--A--L--E--H--K--D--R--E--D--Y--V--P--Y--T--G--E--K--K--G--K--I--F--I--P-
GCATCTCCTTTCATATCTGGAGAAAGAAGCATTGGAGCATAAAGACAGGGAAGACTATGTGCCCTACACTGGAGAAAAAAAAGGGAAAATATTTATCCCC
.::.:::::::::::.::::::::.::::: :::::::::::.:::::::::::::::::::::::::::::::::::::::   ::::::::::::::.
ACACCTCCTTTCATACCTGGAGAAGGAAGCTTTGGAGCATAAGGACAGGGAAGACTATGTGCCCTACACTGGAGAAAAAAAA---AAAATATTTATCCCT
--H--L--L--S--Y--L--E--K--E--A--L--E--H--K--D--R--E--D--Y--V--P--Y--T--G--E--K--K-----K--I--F--I--P-

----------------------------------------------------------------------------------------------------
-K--Q--K--P--V--Q--T--F--T--E--E--K--V--S--L--D--P--E--L--E--E--A--L--T--S--A--S--D--T--E--L--C--D--
AAACAGAAACCTGTACAGACTTTTACAGAAGAAAAAGTGTCTCTTGATCCAGAATTAGAAGAAGCTTTGACAAGTGCTTCTGATACAGAATTGTGTGACC
::.:::::::::::::::::::::::::::::::::::.::::::::::::::.:::::::::::::::::::::::::::::.::::::::::::::::
AAGCAGAAACCTGTACAGACTTTTACAGAAGAAAAAGTATCTCTTGATCCAGAGTTAGAAGAAGCTTTGACAAGTGCTTCTGACACAGAATTGTGTGACC
-K--Q--K--P--V--Q--T--F--T--E--E--K--V--S--L--D--P--E--L--E--E--A--L--T--S--A--S--D--T--E--L--C--D--

-----><----------------------------------------------------------------------------------------><---
L--A--A--I--L--G--M--H--N--L--I--T--N--T--K--F--C--N--I--M--G--S--S--N--G--V--D--Q--E--H--F--S--N--V
TCGCAGCAATTCTTGGGATGCACAATTTGATAACGAATACAAAGTTCTGTAATATAATGGGAAGTAGTAATGGTGTTGACCAAGAACATTTTTCAAATGT
:::::   ::::::::::::::::::::::::::::::::: :::::::.::::::.::::::::::::::::::::::::::::::::::::::     
TCGCA---ATTCTTGGGATGCACAATTTGATAACGAATACACAGTTCTGCAATATAGTGGGAAGTAGTAATGGTGTTGACCAAGAACATTTTTCA-----
L--A-----I--L--G--M--H--N--L--I--T--N--T--Q--F--C--N--I--V--G--S--S--N--G--V--D--Q--E--H--F--S------

----------------------------------------------------------------------------------------------------
--V--K--G--E--K--I--L--P--V--F--D--E--P--P--N--P--T--N--V--E--E--S--L--K--R--T--K--E--N--D--A--H--L-
GGTCAAAGGTGAAAAGATTCTTCCGGTATTTGATGAGCCACCAAATCCAACCAATGTAGAAGAGAGTTTGAAGAGAACTAAAGAAAACGATGCTCATCTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------><------------------------------------------------------------------------
-V--E--V--N--L--N--N--I--K--N--I--P--I--P--T--L--K--D--F--A--K--A--L--E--T--N--T--H--V--K--C--F--S--
GTTGAAGTTAATTTGAATAATATAAAGAATATCCCAATTCCAACCCTAAAAGATTTTGCAAAGGCTTTGGAAACCAACACACATGTGAAATGTTTCAGTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------><----------------------------------------------------------------
L--A--A--T--R--S--N--D--P--V--A--T--A--F--A--E--M--L--K--V--N--K--T--L--K--S--L--N--V--E--S--N--F--I
TTGCAGCCACCCGGAGCAATGACCCTGTTGCTACTGCTTTTGCAGAAATGCTGAAAGTGAACAAAACTTTGAAGAGCTTAAATGTGGAGTCCAACTTTAT
                                   ::::::::::: :::::.:.::::::::::: ::::::::::::::::.::::::::::::::::
-----------------------------------GCTTTTGCAGATATGCTAAGAGTGAACAAAAATTTGAAGAGCTTAAATATGGAGTCCAACTTTAT
------------------------------------A--F--A--D--M--L--R--V--N--K--N--L--K--S--L--N--M--E--S--N--F--I

------------------------------------------------------------------------------><--------------------
--T--G--V--G--I--L--A--L--I--D--A--L--R--D--N--E--T--L--A--E--L--K--I--D--N--Q--R--Q--Q--L--G--T--A-
CACGGGAGTTGGGATTCTGGCACTGATTGATGCGTTAAGAGATAATGAAACCCTGGCAGAGCTCAAGATTGACAATCAGAGGCAGCAGTTGGGGACAGCT
.::.::::.:::::::::.:::::::: ::::: .:.:::::::::::::::::::: ::::::::::::::::::::::::::::::.:::::::::::
TACAGGAGCTGGGATTCTAGCACTGATGGATGCTCTGAGAGATAATGAAACCCTGGCTGAGCTCAAGATTGACAATCAGAGGCAGCAGCTGGGGACAGCT
--T--G--A--G--I--L--A--L--M--D--A--L--R--D--N--E--T--L--A--E--L--K--I--D--N--Q--R--Q--Q--L--G--T--A-

----------------------------------------------------------------------------------------------------
-V--E--L--E--M--A--K--M--L--E--E--N--T--N--I--L--K--F--G--Y--Q--F--T--Q--Q--G--P--R--T--R--A--A--N--
GTAGAATTGGAAATGGCCAAGATGCTTGAGGAAAATACAAATATCCTTAAATTTGGATATCAGTTTACACAGCAGGGACCACGAACCAGAGCAGCTAATG
:::::::::::::::::::::::::::::::::::::: ::::::::::::::::::::::::::::: ::.:::::::: ::::::::.::::::::::
GTAGAATTGGAAATGGCCAAGATGCTTGAGGAAAATACCAATATCCTTAAATTTGGATATCAGTTTACTCAACAGGGACCTCGAACCAGGGCAGCTAATG
-V--E--L--E--M--A--K--M--L--E--E--N--T--N--I--L--K--F--G--Y--Q--F--T--Q--Q--G--P--R--T--R--A--A--N--

-----------------------><--------------------------------->
A--I--T--K--N--N--D--L--V--R--K--R--R--V--E--G--D--H--Q--*-
CTATAACAAAAAACAATGACTTAGTGCGTAAGAGACGAGTTGAAGGAGATCACCAGTAA
:::::::::::::.:::::::::                                    
CTATAACAAAAAATAATGACTTA------------------------------------
A--I--T--K--N--N--D--L-------------------------------------

Pig Consensus Sequence

>BGISUST0000882582
ATGGCACTATCATTCCGGAAGGACTTAGAAAAGTACAAGGACCTCGATGAAGATGAACTCCTTGGGAATCTATCAGAAGTAGAGCTGAAACAACTAGAAA
CTGTTCTGGATGATCTTGACCCTGAGAATGCCCTTCTGCCTGCAGGATTCCGGCAGAAGAACCAGACATCAAAGTCTGCCACAGGGCCATTCGATAGAGA
ACACCTCCTTTCATACCTGGAGAAGGAAGCTTTGGAGCATAAGGACAGGGAAGACTATGTGCCCTACACTGGAGAAAAAAAA---AAAATATTTATCCCT
AAGCAGAAACCTGTACAGACTTTTACAGAAGAAAAAGTATCTCTTGATCCAGAGTTAGAAGAAGCTTTGACAAGTGCTTCTGACACAGAATTGTGTGACC
TCGCA---ATTCTTGGGATGCACAATTTGATAACGAATACACAGTTCTGCAATATAGTGGGAAGTAGTAATGGTGTTGACCAAGAACATTTTTCA-----
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
-----------------------------------GCTTTTGCAGATATGCTAAGAGTGAACAAAAATTTGAAGAGCTTAAATATGGAGTCCAACTTTAT
TACAGGAGCTGGGATTCTAGCACTGATGGATGCTCTGAGAGATAATGAAACCCTGGCTGAGCTCAAGATTGACAATCAGAGGCAGCAGCTGGGGACAGCT
GTAGAATTGGAAATGGCCAAGATGCTTGAGGAAAATACCAATATCCTTAAATTTGGATATCAGTTTACTCAACAGGGACCTCGAACCAGGGCAGCTAATG
CTATAACAAAAAATAATGACTTA------------------------------------


>BGISUSP0000882582
MALSFRKDLEKYKDLDEDELLGNLSEVELKQLETVLDDLDPENALLPAGFRQKNQTSKSATGPFDREHLLSYLEKEALEHKDREDYVPYTGEKK-KIFIP
KQKPVQTFTEEKVSLDPELEEALTSASDTELCDLA-ILGMHNLITNTQFCNIVGSSNGVDQEHFS-----------------------------------
---------------------------------------------AFADMLRVNKNLKSLNMESNFITGAGILALMDALRDNETLAELKIDNQRQQLGTA
VELEMAKMLEENTNILKFGYQFTQQGPRTRAANAITKNNDL------------