Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000183604 (click for geneview)
Transcript ID ENST00000309865(link to ensembl)
Symbol Q6P435_HUMAN
Localtion Chromosome:16:30203846:30254196:-1 band: 16p11.2
Description LAT1-3TM protein.
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<------------------------------------------------------------------------------><-------------------
-M--S--R--R--A--P--G--S--R--L--S--S--G--G--T--N--Y--S--R--S--W--N--D--W--Q--P--R--T--D--S--A--S--A--
ATGAGCCGCAGAGCCCCGGGGTCTCGGCTGAGCAGCGGCGGCACCAACTATTCGCGGAGCTGGAATGACTGGCAACCCAGAACTGATAGTGCATCAGCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
D--P--G--N--L--K--Y--S--S--S--R--D--R--G--G--S--S--S--Y--G--L--Q--P--S--N--S--A--V--V--S--R--Q--R--H
ACCCAGGTAATTTAAAATATTCTTCATCCAGAGATAGAGGTGGTTCTTCCTCTTACGGACTGCAACCTTCAAATTCAGCTGTGGTGTCTCGGCAAAGGCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------><-------------------------------------------------------
--D--D--T--R--V--H--A--D--I--Q--N--D--E--K--G--G--Y--S--V--N--G--G--S--G--E--N--T--Y--G--R--K--S--L-
CGATGATACCAGAGTCCACGCTGACATACAGAATGACGAAAAGGGTGGCTACAGTGTCAATGGAGGATCTGGGGAAAATACTTATGGTCGGAAGTCGTTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------------------------------->
-G--Q--E--L--R--V--N--N--V--T--S--P--E--F--T--S--V--Q--H--G--S--R--A--L--A--T--K--D--M--R--K--S--Q--
GGGCAAGAGCTGAGGGTTAACAATGTGACCAGCCCTGAGTTCACCAGTGTTCAGCATGGCAGTCGTGCTTTAGCCACCAAAGACATGAGGAAATCACAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

<------------------------------------------------------------------------------>
E--R--S--M--S--Y--C--D--E--S--R--L--S--N--L--L--R--R--I--T--R--E--D--D--R--D--*-
AGAGATCGATGTCTTATTGTGATGAGTCTCGACTGTCAAATCTTCTTCGGAGGATCACCCGGGAAGACGACAGAGACTGA
                                                                                
--------------------------------------------------------------------------------
--------------------------------------------------------------------------------