Sequences
EST Library Info
mgp2Mammary gland - 7 days pre birth
Clusters
Oligos
SNPs

Gene ID ENSG00000174880 (click for geneview)
Transcript ID ENST00000311549(link to ensembl)
Localtion Chromosome:14:102684687:102778062:1 band: 14q32.32
Description  
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--T--N--T--K--G--K--R--R--G--T--R--C-----M--F--S--R--P--C--G--K--H--G--I--F--P--L--A--T--Y--M--R--
ATGACGAACACAAAGGGAAAGAGGAGAGGCACCCGATGT---ATGTTCTCCAGGCCTTGTGGAAAACATGGAATTTTTCCTTTGGCCACGTACATGCGAA
:::::.:::::.::::::::::::::.::::::::       ::::::::. :::::: :.:::::::::::.:. :::::::::::::.::::::::::
ATGACAAACACGAAGGGAAAGAGGAGGGGCACCCGCGTAT--ATGTTCTCTCGGCCTTTTAGAAAACATGGAGTCGTTCCTTTGGCCACATACATGCGAA
-M--T--N--T--K--G--K--R--R--G--T--R--V--\--M--F--S--R--P--F--R--K--H--G--V--V--P--L--A--T--Y--M--R--

-------------------------------------------------------><-------------------------------------------
M--Y--K--K--G--D--T--V--D--I--K--G--M--G--T--V--Q--K--G--P--H--K--C--H--H--G--K--A--G--R--V--Y--D--V
TGTATAAGAAAGGTGATACTGTAGACATCAAGGGAATGGGAACTGTTCAAAAAGGACCGCACAAGTGTCACCATGGCAAAGCTGGAAGAGTCTACGATGT
: ::.:::::::::::::.::::::::::::::::::::: ::::::::::::::::: :::::::::.:::::::::::.::::::::::::::.::::
TCTACAAGAAAGGTGATATTGTAGACATCAAGGGAATGGGCACTGTTCAAAAAGGACCCCACAAGTGTTACCATGGCAAAACTGGAAGAGTCTACAATGT
I--Y--K--K--G--D--I--V--D--I--K--G--M--G--T--V--Q--K--G--P--H--K--C--Y--H--G--K--T--G--R--V--Y--N--V

----------------------------------------------------------------------------------------------------
--P--Q--H--A--V--G--I--A--V--D--K--Q--A--K--G--K--I--P--A--K--R--T--N--V--R--I--E--H--M--K--H--S--K-
TCCCCAGCATGCTGTTGGCATTGCTGTAGACAAACAAGCTAAGGGCAAGATTCCTGCCAAGAGAACTAATGTGCGTATTGAGCACATGAAGCACTCTAAG
  :::::::::::::::::::::.::::.:::::::.:.::::                                                         
AACCCAGCATGCTGTTGGCATTGTTGTAAACAAACAGGTTAAG---------------------------------------------------------
--T--Q--H--A--V--G--I--V--V--N--K--Q--V--K----------------------------------------------------------

------------------------------------------------------------------><------------------------><------
-S--R--D--S--F--L--R--R--V--K--E--N--D--Q--K--K--K--E--A--T--E--K--E--K--G--T--W--I--Q--L--S--Q--A--
AGCCGAGACAGCTTCCTGAGACGCGTGAAGGAAAATGATCAGAAAAAGAAAGAGGCCACAGAGAAAGAGAAAGGTACCTGGATTCAACTAAGCCAGGCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------------------------------->
A--P--P--R--E--A--H--F--V--R--T--N--G--K--E--P--E--L--L--E--P--I--P--Y--G--F--M--A--*-
CTCCACCCAGAGAAGCACACTTTGTGAGAACCAACGGGAAGGAGCCTGAACTGCTGGAACCTATTCCCTATGGATTCATGGCATAA
                                                                                      
--------------------------------------------------------------------------------------
--------------------------------------------------------------------------------------

Pig Consensus Sequence

>BGISUST0000881540
ATGACAAACACGAAGGGAAAGAGGAGGGGCACCCGCGTaaTGTTCTCTCGGCCTTTTAGAAAACATGGAGTCGTTCCTTTGGCCACATACATGCGAATCT
ACAAGAAAGGTGATATTGTAGACATCAAGGGAATGGGCACTGTTCAAAAAGGACCCCACAAGTGTTACCATGGCAAAACTGGAAGAGTCTACAATGTAAC
CCAGCATGCTGTTGGCATTGTTGTAAACAAACAGGTTAAG------------------------------------------------------------
----------------------------------------------------------------------------------------------------
-----------------------------------------------------------------------------------


>BGISUSP0000881540
MTNTKGKRRGTRVMFSRPFRKHGVVPLATYMRIYKKGDIVDIKGMGTVQKGPHKCYHGKTGRVYNVTQHAVGIVVNKQVK--------------------
-------------------------------------------------------------