Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000174450 (click for geneview)
Transcript ID ENST00000312015(link to ensembl)
Symbol NP_872367.1
Localtion Chromosome:15:21236131:21243483:-1 band: 15q11.2
Description hypothetical protein FLJ36144
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<----------------------------------------------------------------------------------><---------------
-M--W--P--Q--P--H--L--P--P--H--P--M--M--S--E--K--T--R--Q--N--K--L--A--E--A--K--K--K--F--T--D--Y--R--
ATGTGGCCCCAACCCCACCTCCCTCCCCACCCCATGATGTCAGAAAAAACCAGACAGAACAAATTGGCTGAGGCCAAGAAAAAGTTTACAGACTATCGTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
Q--W--N--I--A--G--V--G--T--R--A--T--D--T--K--K--K--K--I--N--N--G--T--N--P--E--T--T--T--S--E--G--C--H
AGTGGAACATTGCTGGTGTTGGTACCAGAGCAACTGACACCAAAAAGAAGAAAATAAATAATGGCACTAACCCTGAGACAACCACTTCGGAGGGTTGCCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------><----------------------------><-------------------------------------------------><-----
--S--P--E--D--T--Q--Q--N--R--A--Q--L--K--E--E--K--K--A--S--H--Q--H--Q--E--A--L--R--R--E--I--E--A--Q-
TTCACCTGAGGATACACAACAGAACCGAGCGCAGCTGAAAGAAGAAAAGAAGGCAAGCCACCAACATCAGGAAGCCCTAAGGCGGGAGATAGAGGCCCAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-D--H--T--I--R--I--L--T--C--Q--K--T--E--L--E--T--A--L--Y--Y--S--Q--D--A--A--R--K--F--E--D--G--N--L--
GATCATACAATACGAATTCTCACGTGTCAGAAAACTGAACTGGAGACAGCGCTCTATTACAGCCAGGATGCTGCCAGGAAATTTGAAGATGGGAACCTGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
G--T--P--S--S--F--N--L--A--L--S--Q--A--F--R--G--S--P--L--G--C--V--S--T--S--L--I--P--G--E--S--K--D--L
GCACCCCATCATCCTTCAACCTGGCACTTTCACAGGCCTTTAGGGGGAGTCCTTTGGGCTGTGTCTCAACCTCTCTCATTCCAGGAGAGTCCAAGGATCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------------------------------------><--------
--A--G--R--L--H--H--S--W--H--F--A--G--E--L--Q--R--A--L--S--A--V--S--T--W--H--K--K--A--D--R--Y--I--E-
CGCCGGCCGCTTGCATCATTCCTGGCACTTTGCAGGAGAGTTACAGCGGGCTCTCTCTGCTGTGTCCACATGGCACAAGAAGGCAGACAGGTACATCGAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------><-------------------------------------------------
-E--L--T--K--E--R--D--A--L--S--L--E--L--Y--R--N--T--I--T--N--E--E--L--K--K--K--N--A--E--L--Q--E--K--
GAGTTAACAAAGGAGAGGGACGCCCTGAGTCTGGAACTGTACAGGAACACCATAACCAATGAGGAGCTGAAGAAGAAAAATGCCGAACTACAAGAAAAAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------------------------------------><-------
L--R--L--A--E--S--E--K--S--E--I--Q--L--N--V--K--E--L--K--R--K--L--E--R--A--K--F--L--L--P--Q--V--Q--T
TTCGACTTGCAGAATCTGAAAAGTCTGAGATCCAGCTCAACGTGAAGGAGCTAAAAAGGAAACTGGAGAGGGCCAAGTTCCTGCTGCCACAGGTTCAAAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--N--T--L--Q--E--E--M--W--R--Q--E--E--E--L--R--E--Q--E--K--K--I--R--K--Q--E--E--K--M--W--R--Q--E--E-
CAACACTTTGCAGGAGGAGATGTGGAGGCAGGAGGAGGAGCTACGGGAGCAGGAAAAGAAGATACGGAAGCAGGAGGAGAAGATGTGGAGACAGGAGGAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-R--L--R--E--Q--E--G--K--M--R--E--Q--E--E--K--M--R--R--Q--E--K--R--L--R--E--Q--E--K--E--L--R--E--Q--
AGACTGCGGGAGCAGGAGGGGAAGATGCGGGAGCAGGAGGAGAAGATGCGGAGACAGGAGAAGAGGCTGCGAGAGCAGGAGAAGGAGCTGCGGGAGCAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
E--K--E--L--R--E--Q--K--K--L--R--E--Q--E--E--Q--M--Q--E--Q--E--E--K--M--W--E--Q--E--E--K--M--R--E--Q
AGAAGGAGCTGCGGGAGCAGAAGAAGCTGCGGGAGCAGGAGGAGCAGATGCAGGAGCAGGAGGAGAAGATGTGGGAGCAGGAGGAGAAGATGCGGGAGCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--E--E--K--M--W--R--Q--E--E--R--L--W--E--Q--E--K--Q--M--R--E--Q--E--Q--K--M--R--D--Q--E--E--R--M--W-
GGAAGAGAAGATGTGGAGACAGGAGGAGAGGCTGTGGGAGCAGGAGAAGCAGATGCGGGAGCAGGAGCAGAAGATGCGGGACCAAGAGGAGAGGATGTGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-E--Q--D--E--R--L--R--E--K--E--E--R--M--R--E--Q--E--K--M--W--E--Q--V--E--K--M--R--E--E--K--K--M--Q--
GAGCAGGACGAGAGGCTACGGGAGAAGGAGGAGAGGATGCGGGAGCAGGAGAAGATGTGGGAGCAGGTGGAGAAGATGCGGGAGGAGAAGAAGATGCAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
E--Q--E--K--K--T--R--D--Q--E--E--K--M--Q--E--E--E--R--I--R--E--R--E--K--K--M--R--E--E--E--E--T--M--R
AGCAGGAGAAGAAGACGCGGGACCAGGAGGAGAAGATGCAAGAGGAGGAGAGGATACGGGAGCGGGAGAAGAAGATGCGGGAAGAGGAGGAGACGATGCG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--E--Q--E--E--K--M--Q--K--Q--E--E--N--M--W--E--Q--E--E--K--E--W--Q--Q--Q--R--L--P--E--Q--K--E--K--L-
GGAGCAGGAGGAGAAGATGCAGAAGCAGGAGGAGAATATGTGGGAGCAGGAAGAGAAGGAGTGGCAGCAGCAGAGGCTGCCGGAACAGAAGGAGAAGCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-W--E--Q--E--K--M--Q--E--Q--E--E--K--I--W--E--Q--E--E--K--I--R--D--Q--E--E--M--W--G--Q--E--K--K--M--
TGGGAACAGGAGAAGATGCAGGAGCAGGAGGAGAAGATATGGGAGCAGGAGGAGAAGATACGGGACCAGGAGGAGATGTGGGGGCAGGAGAAGAAGATGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------><-------------------------------------------------------------------
W--R--Q--E--K--M--R--E--Q--E--D--E--M--R--E--K--E--E--R--I--R--D--Q--K--E--K--M--Q--E--R--L--P--E--H
GGCGGCAGGAGAAGATGCGGGAGCAGGAAGATGAGATGCGAGAGAAGGAGGAGAGGATACGAGATCAGAAAGAGAAGATGCAGGAGAGGCTGCCAGAGCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--E--E--R--C--S--E--P--C--L--P--P--S--K--V--L--C--N--M--S--H--T--G--S--V--E--P--A--G--G--E--A--G--E-
CGAGGAGCGGTGCTCAGAGCCCTGCCTCCCTCCCTCCAAAGTTCTTTGTAATATGAGCCACACTGGCAGTGTGGAGCCTGCAGGAGGAGAGGCTGGGGAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-G--S--P--Q--D--N--P--T--A--Q--E--I--M--Q--L--F--C--G--M--K--N--A--Q--Q--C--P--G--L--G--S--T--S--C--
GGTTCTCCGCAGGACAACCCCACTGCACAGGAGATCATGCAGCTGTTTTGTGGGATGAAGAACGCCCAGCAGTGCCCAGGATTAGGCAGTACCTCCTGCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------->
I--P--F--F--Y--R--G--D--K--R--K--M--K--I--I--N--I--*-
TCCCATTCTTCTACCGAGGAGACAAGAGAAAGATGAAGATCATCAATATCTAA
                                                     
-----------------------------------------------------
-----------------------------------------------------