Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000177842 (click for geneview)
Transcript ID ENST00000314529(link to ensembl)
Symbol ZNF620
Localtion Chromosome:3:40522535:40533896:1 band: 3p22.1
Description zinc finger protein 620 [Source:RefSeq_peptide;Acc:NP_787084]
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--V--G--G--L--P--G--N--V--S--Q--H--L--D--F--G--S--S--L--E--Q--P--Q--G--H--W--I--I--K--T--K--S--K--
ATGGTGGGGGGCCTGCCAGGGAATGTTTCCCAGCACCTTGACTTTGGGAGCAGCCTAGAGCAGCCACAAGGTCATTGGATAATTAAGACAAAGTCAAAGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
R--R--H--F--T--D--T--S--A--R--H--H--E--A--Y--E--V--K--N--G--E--K--F--E--K--L--G--K--N--I--S--V--S--T
GGAGACATTTCACAGATACCTCAGCCAGGCACCATGAGGCCTATGAGGTCAAGAATGGAGAGAAGTTTGAGAAATTAGGAAAAAATATTAGCGTCAGCAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--Q--L--T--T--N--Q--T--N--P--S--G--Q--I--S--Y--E--C--G--Q--C--G--R--Y--F--I--Q--M--A--D--F--H--R--H-
ACAACTCACTACAAATCAGACAAATCCTAGTGGTCAGATATCTTATGAATGTGGACAATGTGGCAGATATTTCATTCAAATGGCAGACTTCCACCGACAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-E--K--C--H--T--G--E--K--S--F--E--C--K--E--C--G--K--Y--F--R--Y--N--S--L--L--I--R--H--Q--I--I--H--T--
GAGAAATGTCACACTGGTGAAAAGTCTTTTGAATGCAAAGAATGTGGAAAATACTTCAGATATAACTCATTACTTATTCGGCATCAGATAATTCACACTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
G--K--K--P--F--K--C--K--E--C--G--K--G--L--S--S--D--T--A--L--I--Q--H--Q--R--I--H--T--G--E--K--P--Y--E
GAAAGAAACCATTTAAATGTAAAGAATGTGGAAAAGGTTTAAGTTCAGACACAGCCTTGATTCAGCATCAGAGAATCCACACTGGAGAAAAGCCCTATGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--C--K--E--C--G--K--A--F--S--S--S--S--V--F--L--Q--H--Q--R--F--H--T--G--E--K--L--Y--E--C--N--E--C--W-
ATGTAAGGAGTGCGGCAAGGCCTTCAGTAGCAGCTCTGTCTTCCTCCAGCACCAGAGGTTCCACACTGGGGAGAAGCTCTATGAATGTAACGAATGTTGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-K--T--F--S--C--S--S--S--F--T--V--H--Q--R--M--H--T--G--E--K--P--Y--E--C--K--E--C--G--K--R--L--S--S--
AAAACTTTCAGTTGCAGCTCAAGTTTCACTGTCCATCAGCGAATGCACACTGGGGAGAAACCTTATGAATGTAAAGAGTGTGGAAAACGATTAAGCTCCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
N--T--A--L--T--Q--H--Q--R--I--H--T--G--E--K--P--F--E--C--K--E--C--G--K--A--F--N--Q--K--I--T--L--I--Q
ACACAGCCTTGACTCAGCATCAGCGAATTCACACTGGGGAGAAGCCCTTTGAATGTAAGGAGTGTGGGAAGGCATTCAATCAGAAAATAACCCTGATTCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--H--Q--R--V--H--T--G--E--K--P--Y--E--C--K--V--C--G--K--T--F--S--W--C--G--R--F--I--L--H--Q--K--L--H-
GCACCAGCGAGTTCACACTGGCGAGAAACCTTATGAGTGTAAAGTGTGTGGTAAAACCTTCAGCTGGTGTGGAAGATTCATTCTGCATCAGAAACTACAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------->
-T--Q--K--T--P--V--Q--A--*-
ACTCAGAAGACACCTGTCCAAGCATAG
                           
---------------------------
---------------------------