Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000180598 (click for geneview)
Transcript ID ENST00000315486(link to ensembl)
Symbol NP_056184.1
Localtion Chromosome:16:32172144:32174741:1 band: 16p11.2
Description TP53TG3 protein
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--R--A--S--P--C--I--S--Q--P--A--A--S--W--H--P--R--P--S--A--L--R--P--T--A--G--S--G--P--D--T--R--T--
ATGCGCGCCTCACCCTGCATCTCCCAGCCCGCAGCCAGCTGGCATCCTAGACCCTCTGCCCTGCGACCAACAGCCGGGAGCGGACCAGACACCAGAACTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
P--G--T--V--E--D--G--S--A--P--C--P--A--F--R--S--P--A--V--S--P--C--G--E--E--P--C--C--F--Q--I--S--P--A
CCGGAACGGTTGAAGACGGTTCCGCTCCCTGTCCCGCCTTTCGCAGCCCAGCAGTTTCGCCCTGCGGAGAGGAGCCTTGCTGTTTCCAAATCTCTCCTGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--E--E--T--L--E--L--G--R--L--V--S--P--G--N--C--D--T--L--S--P--R--A--A--G--F--Y--A--C--H--V--R--S--L-
TGAAGAGACATTGGAGCTAGGGCGGCTAGTTTCACCTGGTAATTGTGACACCCTGTCTCCTCGAGCTGCAGGCTTTTATGCTTGTCATGTTCGAAGTTTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------><----------------------------------->
-I--P--C--R--S--T--K--G--R--W--P--L--T--A--S--A--A--G--L--S--R--H--A--Q--C--G--P--S--L--G--L--G--*-
ATACCTTGCAGATCAACAAAGGGTCGGTGGCCTCTCACTGCCTCCGCGGCAGGGTTGTCAAGACATGCGCAGTGCGGCCCGTCCCTAGGGCTGGGTTAA
                                                                                                   
---------------------------------------------------------------------------------------------------
---------------------------------------------------------------------------------------------------