Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000180683 (click for geneview)
Transcript ID ENST00000315644(link to ensembl)
Symbol Q8N7A4_HUMAN
Localtion Chromosome:17:9989556:9991002:1 band: 17p13.1
Description Hypothetical protein FLJ25865.
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--A--H--Y--F--V--F--V--G--A--R--T--T--I--S--T--M--R--T--C--P--R--S--P--K--A--R--I--F--V--G--G--F--
ATGGCTCATTATTTTGTTTTTGTGGGAGCAAGAACAACCATCTCAACAATGAGAACTTGCCCCCGTAGTCCCAAAGCCAGGATCTTCGTGGGAGGGTTCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
Q--R--V--R--P--R--P--S--E--P--A--D--P--C--H--G--S--G--P--A--L--M--D--L--E--R--M--V--A--T--E--D--K--S
AGAGGGTGAGGCCCAGGCCCTCTGAACCAGCAGACCCTTGTCATGGATCAGGTCCTGCGCTGATGGACCTTGAGAGAATGGTGGCTACAGAGGACAAATC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--R--K--G--I--H--T--H--A--R--R--Q--R--K--H--L--V--L--P--K--L--G--G--K--T--V--H--I--E--H--Q--G--T--L-
CAGAAAAGGCATCCACACACATGCAAGAAGGCAGAGGAAGCATCTGGTTCTCCCCAAACTCGGGGGTAAAACTGTCCACATCGAGCACCAAGGCACCCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------->
-N--F--H--R--T--K--L--D--N--P--R--T--L--R--Y--L--G--P--K--L--V--L--N--*-
AACTTCCACAGAACCAAGTTAGATAATCCCAGAACTTTGAGGTATCTGGGCCCAAAACTAGTATTAAATTGA
                                                                        
------------------------------------------------------------------------
------------------------------------------------------------------------