Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000140181 (click for geneview)
Transcript ID ENST00000317076(link to ensembl)
Symbol NP_001019852.1
Localtion Chromosome:15:20833729:20929700:-1 band: 15q11.2
Description PREDICTED: similar to KIAA0393 protein
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-------------------------------><------------------------------------------------------------------
-M--H--A--F--C--V--G--Q--Y--L--E--P--D--Q--E--G--V--T--I--P--D--L--G--S--L--S--S--P--L--I--D--T--E--
ATGCACGCATTTTGTGTTGGCCAGTATTTGGAGCCTGACCAAGAAGGCGTCACCATACCAGATCTGGGGAGTCTCTCCTCACCTCTGATAGACACAGAGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------------------------------------------><---------------
R--N--L--G--L--L--L--G--L--H--A--S--Y--L--A--M--S--T--P--L--S--P--V--E--I--E--C--A--K--W--L--Q--S--S
GGAATCTGGGCCTGCTTCTCGGATTACACGCTTCCTATTTAGCAATGAGCACACCGCTGTCTCCTGTCGAGATTGAATGTGCCAAATGGCTTCAGTCATC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--I--F--S--G--G--L--Q--T--S--Q--I--H--Y--S--Y--N--E--E--K--D--E--D--H--C--S--S--P--G--G--T--P--A--S-
CATCTTCTCTGGAGGCCTGCAGACCAGCCAGATCCACTACAGCTACAACGAGGAGAAAGACGAGGACCACTGCAGCTCCCCAGGGGGCACACCTGCCAGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------------------------------><
-K--S--R--L--C--S--H--R--R--A--L--G--D--H--S--Q--A--F--L--Q--A--I--A--D--N--N--I--Q--D--H--N--V--K--
AAATCTCGACTCTGCTCCCACAGACGGGCCCTGGGGGACCATTCCCAGGCATTTCTGCAAGCCATTGCAGACAACAACATTCAGGATCACAACGTGAAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
D--F--L--C--Q--I--E--R--Y--C--R--Q--C--H--L--T--T--P--I--M--F--P--P--E--H--P--V--E--E--V--G--R--L--L
ACTTTTTGTGTCAAATAGAAAGGTACTGTAGGCAGTGCCATTTGACCACACCGATCATGTTTCCCCCCGAGCATCCCGTGGAAGAGGTCGGTCGCTTGCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------><-------------------------------------------------------------------
--L--C--C--L--L--K--H--E--D--L--G--H--V--A--L--S--L--V--H--A--G--A--L--D--I--E--Q--V--K--H--R--T--L-
GTTATGTTGCCTCTTAAAACATGAAGATTTAGGTCATGTGGCATTATCTTTAGTTCATGCAGGTGCACTTGATATTGAGCAAGTAAAGCACAGAACGTTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------------------><---------------------------------------
-P--K--S--V--V--D--V--C--R--V--V--Y--Q--A--K--C--S--L--I--K--T--H--Q--E--Q--G--R--S--Y--K--E--V--C--
CCTAAGTCAGTGGTGGATGTTTGTAGAGTTGTCTACCAAGCAAAATGTTCGCTCATTAAGACTCATCAAGAACAGGGCCGTTCTTACAAGGAGGTCTGCG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
A--P--V--I--K--R--L--R--F--L--F--N--E--L--R--P--A--V--C--N--D--L--S--I--M--S--K--F--K--L--L--S--S--L
CTCCTGTCATCAAACGTTTGAGATTCCTCTTTAATGAATTGAGACCTGCTGTTTGTAATGACCTCTCTATAATGTCTAAGTTTAAATTGTTAAGTTCTTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------><-------------------------------------------
--P--H--W--R--R--I--A--Q--K--I--I--R--E--P--R--K--K--R--V--P--K--K--P--E--S--T--D--D--E--E--K--I--G-
GCCCCATTGGAGGAGGATAGCTCAGAAGATAATTCGAGAACCAAGGAAAAAGAGAGTTCCTAAGAAGCCAGAATCTACGGATGATGAAGAAAAAATTGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------------------------------------------------><---------
-N--E--E--S--D--L--E--E--A--C--I--L--P--H--S--P--I--N--V--D--K--R--P--I--A--I--K--S--P--K--D--K--W--
AACGAAGAGAGTGATTTAGAAGAAGCTTGCATTTTGCCTCATAGTCCAATAAATGTGGACAAGAGACCCATTGCAATTAAATCACCCAAGGACAAATGGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
Q--P--L--L--S--T--V--T--D--V--H--K--Y--K--W--L--K--Q--N--V--Q--G--L--Y--P--Q--S--P--L--L--S--T--I--A
AGCCGCTGTTGAGTACTGTTACAGATGTTCACAAATACAAGTGGTTGAAGCAGAATGTGCAGGGTCTTTATCCGCAGTCTCCACTCCTCAGTACAATTGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------><--------------------------------------
--E--F--A--L--K--E--E--P--V--D--V--E--K--R--K--C--L--L--K--Q--L--E--R--A--E--V--R--L--E--G--I--D--T-
TGAATTTGCCCTTAAAGAAGAGCCAGTGGATGTGGAAAAGAGAAAGTGCCTACTAAAACAGTTGGAGAGAGCAGAGGTTCGCCTGGAAGGGATAGATACA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-I--L--K--L--Y--L--V--S--K--N--F--L--L--P--S--V--P--Y--A--M--F--C--G--W--Q--R--L--I--P--E--G--I--D--
ATTTTAAAATTGTATCTGGTGAGCAAGAATTTCTTACTTCCATCTGTGCCGTATGCGATGTTTTGTGGATGGCAAAGACTTATTCCTGAGGGAATCGATA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---><-----------------------------------------------------------------------------------------------
I--G--E--P--L--T--D--C--L--K--D--V--D--L--I--P--P--F--N--R--M--L--L--E--V--T--F--G--K--L--Y--A--W--A
TAGGGGAACCTCTTACTGATTGTTTAAAGGATGTTGATTTGATCCCGCCTTTTAATCGGATGCTGCTGGAAGTCACCTTTGGCAAGCTGTACGCTTGGGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------><-------------------------------------------
--V--Q--N--I--R--N--V--L--V--D--A--S--A--K--F--K--E--L--G--I--Q--P--V--P--L--Q--T--I--T--N--E--N--P-
TGTTCAGAACATTCGAAATGTTTTGGTGGATGCCAGTGCCAAATTTAAAGAGCTTGGTATCCAGCCGGTTCCCCTGCAAACCATCACCAATGAGAACCCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-S--G--P--S--L--G--T--I--P--Q--A--H--F--L--L--V--M--L--S--M--L--T--L--Q--H--S--A--N--N--L--D--L--L--
TCGGGACCGAGCCTGGGGACCATCCCGCAAGCCCACTTCCTCCTGGTGATGCTCAGCATGCTCACCCTGCAGCACAGCGCAAACAACCTTGACCTCCTGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------><---------------------------------------------------
L--N--S--G--T--L--A--L--A--Q--T--A--L--R--L--I--G--P--S--C--D--S--V--E--E--D--M--N--A--S--A--Q--G--A
TCAATTCCGGCACGCTGGCCCTCGCTCAGACGGCACTGCGCCTGATTGGCCCCAGTTGTGACAGCGTTGAGGAAGATATGAATGCTTCTGCCCAAGGTGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--S--A--T--V--L--E--E--T--R--K--E--T--A--P--V--Q--L--P--V--S--G--P--E--L--A--A--M--M--K--I--G--T--R-
TTCTGCCACAGTTTTGGAAGAAACAAGGAAGGAAACGGCTCCTGTGCAGCTCCCTGTTTCAGGGCCAGAACTGGCTGCCATGATGAAGATTGGAACAAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------><---------------------------------------------------------------
-V--M--R--G--V--D--W--K--W--G--D--Q--D--G--P--P--P--G--L--G--R--V--I--G--E--L--G--E--D--G--W--I--R--
GTCATGAGAGGTGTGGACTGGAAATGGGGCGATCAGGATGGGCCTCCTCCAGGCCTAGGCCGAGTGATTGGTGAGCTGGGAGAGGACGGGTGGATAAGAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
V--Q--W--D--T--G--S--T--N--S--Y--R--M--G--K--E--G--K--Y--D--L--K--L--A--E--L--P--A--P--A--Q--P--S--A
TCCAGTGGGACACAGGCAGCACCAACTCCTACAGGATGGGGAAAGAAGGAAAATACGACCTCAAGCTGGCAGAGCTGCCAGCCCCTGCACAGCCCTCAGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------><----------------------------------------------------------------------
--E--D--S--D--T--E--D--D--S--E--A--E--Q--T--E--R--N--I--H--P--T--A--M--M--F--T--S--T--I--N--L--L--Q-
AGAGGATTCGGACACAGAGGACGACTCTGAAGCCGAACAAACTGAAAGGAACATTCACCCCACTGCAATGATGTTTACCAGCACTATTAACTTACTGCAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-T--L--C--L--S--A--G--V--H--A--E--I--M--Q--S--E--A--T--K--T--L--C--G--L--L--R--M--L--V--E--S--G--T--
ACTCTTTGTCTGTCTGCTGGAGTTCATGCTGAGATCATGCAGAGTGAAGCCACCAAGACTTTATGCGGACTGCTGCGAATGTTAGTGGAAAGCGGAACGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------><---------------------------------------------------------------------------------------
T--D--K--T--S--S--P--N--R--L--V--Y--R--E--Q--H--R--S--W--C--T--L--G--F--V--Q--S--I--A--L--T--L--Q--V
CGGACAAGACATCTTCTCCAAACAGGCTGGTGTACAGGGAGCAACACCGGAGCTGGTGCACGCTGGGGTTTGTGCAGAGCATCGCTCTCACGCTGCAGGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------------------------------------------------><-----
--C--G--A--L--S--S--P--Q--W--I--T--L--L--M--K--V--V--E--G--H--A--P--F--T--A--T--S--L--Q--R--Q--I--L-
GTGCGGCGCCCTCAGCTCCCCGCAGTGGATCACGCTGCTCATGAAGGTTGTGGAAGGGCACGCACCCTTCACTGCCACCTCGCTGCAGAGGCAGATCTTA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-A--V--H--L--L--Q--A--V--L--P--S--W--D--K--T--E--R--V--R--D--M--K--C--L--M--E--K--L--F--D--F--L--G--
GCTGTGCATTTGTTGCAAGCAGTCCTTCCGTCATGGGACAAGACCGAAAGGGTGAGGGACATGAAATGCCTCATGGAGAAGCTGTTTGACTTCTTGGGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------><---------------------------------------------------------
S--L--L--T--M--C--S--S--D--V--P--L--L--R--E--S--T--L--R--R--R--R--V--C--P--Q--A--S--L--T--A--T--H--S
GCTTGCTCACTATGTGCTCCTCTGACGTGCCGTTACTCAGAGAGTCCACGCTGAGGCGGCGCAGGGTGTGCCCGCAGGCCTCGCTGACTGCCACCCACAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--S--T--L--A--E--E--V--V--A--L--L--H--T--L--H--S--L--T--R--W--N--G--L--I--N--K--Y--I--N--S--Q--L--R-
CAGCACACTGGCGGAGGAGGTGGTGGCACTGCTGCACACGCTGCACTCCCTGACTCGGTGGAATGGGCTCATCAACAAGTACATCAACTCCCAGCTCCGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------><------------------------------------------------------------
-S--I--T--H--S--F--A--G--R--P--S--K--G--A--Q--L--D--D--Y--F--P--D--S--E--N--P--E--V--G--G--L--M--A--
TCCATCACCCACAGCTTTGCGGGAAGGCCTTCCAAAGGGGCCCAGTTAGATGACTACTTCCCTGATTCCGAGAACCCTGAAGTGGGGGGCCTCATGGCGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
V--L--A--V--V--G--G--I--D--G--R--L--C--L--G--G--Q--V--V--H--D--D--F--G--E--V--T--M--T--R--I--T--L--K
TCCTGGCTGTGGTTGGAGGCATCGATGGTCGCCTGTGCCTGGGCGGCCAAGTTGTGCACGATGACTTTGGAGAAGTCACCATGACTCGCATCACCCTGAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------------------------><-----------------------------
--G--K--I--T--V--Q--F--S--D--M--R--T--C--R--V--C--P--L--N--Q--L--K--P--L--P--A--V--A--F--N--V--N--N-
GGGCAAAATCACCGTGCAGTTCTCTGACATGCGGACGTGTCGCGTTTGCCCATTGAATCAGCTGAAACCACTCCCTGCCGTGGCCTTTAATGTGAACAAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-L--P--F--T--E--P--M--L--S--V--W--A--Q--L--V--N--L--A--G--S--K--L--E--K--H--K--I--K--K--S--T--K--Q--
CTGCCCTTCACAGAGCCCATGCTGTCTGTCTGGGCTCAGTTGGTGAACCTCGCTGGAAGCAAGTTAGAAAAGCACAAAATAAAGAAATCGACTAAACAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------><------------------------------------------------------------------------------------------
A--F--A--G--Q--V--D--L--D--L--L--R--R--Q--Q--L--K--L--Y--I--L--K--A--G--R--A--L--F--S--H--Q--D--K--L
CCTTTGCAGGACAAGTGGACCTGGACCTGCTGCGGCGCCAGCAGTTGAAGCTATACATCCTGAAAGCAGGTCGGGCGCTGTTCTCCCACCAGGATAAACT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------><----------------------------------------------
--R--Q--I--L--S--Q--P--A--V--Q--E--T--G--T--V--H--T--D--D--G--A--V--V--S--P--D--L--G--D--M--S--P--E-
GCGGCAGATCCTGTCTCAGCCAGCTGTTCAGGAGACTGGAACTGTTCACACAGATGATGGAGCAGTGGTATCACCTGACCTTGGGGACATGTCTCCTGAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------------------------------------------------------><---
-G--P--Q--P--P--M--I--L--L--Q--Q--L--L--A--S--A--T--Q--P--S--P--V--K--A--I--F--D--K--Q--E--L--E--T--
GGGCCGCAGCCCCCCATGATCCTCTTGCAGCAGCTGCTGGCCTCGGCCACCCAGCCGTCTCCTGTGAAGGCCATATTTGATAAACAGGAACTTGAGACTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
A--A--L--A--V--V--E--S--T--H--P--S--S--P--G--F--E--D--C--S--S--S--E--A--T--T--P--V--N--V--Q--H--I--R
CTGCACTGGCCGTTGTGGAGTCCACTCACCCTTCGAGCCCAGGATTTGAAGACTGCAGCTCCAGTGAGGCCACCACGCCTGTCAACGTGCAGCACATCCG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--P--A--R--V--K--R--R--K--Q--S--P--V--P--A--L--P--I--V--V--Q--L--M--E--M--G--F--P--R--R--N--I--E--F-
CCCTGCCAGAGTGAAGAGGCGCAAGCAGTCACCCGTTCCCGCTCTGCCGATCGTGGTGCAGCTCATGGAGATGGGATTTCCCAGAAGGAACATCGAGTTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------><--------------------------------------------------
-A--L--K--S--L--T--G--A--S--G--N--A--S--G--L--P--G--V--E--A--L--V--G--W--L--L--D--H--S--D--I--Q--V--
GCCCTGAAGTCTCTCACTGGTGCTTCCGGGAATGCGTCCGGCTTGCCTGGTGTGGAAGCCTTGGTCGGGTGGCTGCTGGACCACTCCGACATACAGGTCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------------------------------><-------------
T--E--L--S--D--A--D--T--V--S--D--E--Y--S--D--E--E--V--V--E--D--M--D--D--A--A--Y--S--M--S--T--G--A--V
CGGAGCTCTCAGATGCAGACACGGTGTCCGACGAGTATTCTGACGAGGAGGTGGTGGAGGACATGGATGATGCCGCCTACTCCATGTCTACTGGTGCTGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------------------------------><--------------
--V--T--E--S--Q--T--Y--K--N--R--A--G--F--L--G--N--D--D--Y--A--V--Y--V--R--E--N--I--Q--V--G--M--M--V-
TGTGACGGAGAGCCAGACGTACAAAAACCGAGCTGGTTTCTTGGGTAATGATGATTATGCTGTATATGTGAGAGAGAATATTCAGGTGGGAATGATGGTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-R--C--C--R--T--Y--E--E--V--C--E--G--D--V--M--L--A--K--S--S--S--W--T--E--M--D--C--M--I--S--M--C--S--
AGATGCTGCCGAACATACGAAGAAGTGTGCGAAGGTGATGTGATGTTGGCAAAGTCATCAAGCTGGACAGAGATGGATTGCATGATCTCAATGTGCAGTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------------->
V--T--G--S--R--K--G--A--S--T--G--L--G--T--F--M--W--N--L--*-
TGACTGGCAGCAGAAAGGGGGCATCTACTGGTTTAGGTACATTCATGTGGAACTTATAG
                                                           
-----------------------------------------------------------
-----------------------------------------------------------