Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000137731 (click for geneview)
Transcript ID ENST00000317594(link to ensembl)
Symbol Q8N8W8_HUMAN
Localtion Chromosome:11:117198230:117200669:-1 band: 11q23.3
Description Hypothetical protein FLJ38750.
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-----------------------><--------------------------------------------------------------------------
-M--T--G--L--S--M--D--G--G--G--S--P--K--G--D--V--D--P--F--Y--Y--G--K--P--G--P--L--R--T--L--P--E--P--
ATGACTGGGTTGTCGATGGACGGTGGCGGCAGCCCCAAGGGGGACGTGGACCCGTTCTACTATGGTAAGCCTGGGCCCCTGCGCACCCTTCCTGAGCCCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
S--G--P--L--P--P--S--S--G--L--S--Q--P--Q--V--H--A--L--C--P--L--S--P--L--V--T--T--G--C--C--G--Q--A--A
CAGGACCCCTTCCACCAAGCAGCGGCCTCTCCCAGCCCCAGGTCCATGCTCTGTGCCCCTTATCTCCCCTGGTTACCACGGGCTGCTGCGGGCAGGCTGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--E--R--D--S--C--W--E--R--P--P--I--P--L--L--L--P--S--L--S--G--D--Y--E--T--V--R--N--G--G--L--I--F--A-
GGAGAGAGACAGCTGCTGGGAGAGACCACCCATCCCGCTCCTCTTGCCCTCTCTTTCCGGAGACTATGAGACCGTTCGCAATGGGGGCCTGATCTTCGCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-G--L--A--F--I--V--G--L--L--I--L--L--S--K--W--G--G--L--Q--G--R--G--A--D--Q--G--T--S--L--L--K--A--A--
GGACTGGCCTTCATCGTGGGGCTCCTCATCCTCCTCAGTAAGTGGGGTGGCCTCCAGGGAAGGGGTGCTGACCAGGGCACCTCTCTTCTCAAGGCCGCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------->
E--Q--A--G--F--R--E--L--P--R--E--G--*-
AGCAGGCTGGCTTTCGGGAGTTGCCAAGGGAGGGGTGA
                                      
--------------------------------------
--------------------------------------