Sequences
CT351266reads
CT195819reads
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000179111 (click for geneview)
Transcript ID ENST00000317814(link to ensembl)
Symbol HES7
Localtion Chromosome:17:7965614:7968127:-1 band: 17p13.1
Description hairy and enhancer of split 7 [Source:RefSeq_peptide;Acc:NP_115969]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<----------------------------------------><---------------------------------------------------------
-M--V--T--R--D--R--A--E--N--R--D--G--P--K--M--L--K--P--L--V--E--K--R--R--R--D--R--I--N--R--S--L--E--
ATGGTCACCCGGGATCGAGCTGAGAATAGGGACGGCCCCAAGATGCTCAAGCCGCTTGTGGAGAAGCGGCGCCGGGACCGCATCAACCGCAGCCTGGAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------><-------------------------------------------------------------
E--L--R--L--L--L--L--E--R--T--R--D--Q--N--L--R--N--P--K--L--E--K--A--E--I--L--E--F--A--V--G--Y--L--R
AGCTGAGGCTGCTGCTGCTGGAGCGGACCCGGGACCAGAACCTCCGGAACCCGAAGCTGGAGAAAGCGGAGATATTGGAGTTCGCCGTGGGCTACTTGAG
                                      :::::::::::::::::::::::::::::.::::::.:::::::::::::::::::::::::
--------------------------------------AACCTCCGGAACCCGAAGCTGGAGAAAGCAGAGATACTGGAGTTCGCCGTGGGCTACTTGAG
---------------------------------------N--L--R--N--P--K--L--E--K--A--E--I--L--E--F--A--V--G--Y--L--R

-------------------------><-------------------------------------------------------------------------
--E--R--S--R--V--E--P--P--G--V--P--R--S--P--V--Q--D--A--E--A--L--A--S--C--Y--L--S--G--F--R--E--C--L-
GGAGCGAAGCCGGGTGGAGCCCCCGGGGGTTCCCCGGTCCCCAGTCCAGGACGCCGAGGCGCTCGCCAGCTGCTACTTGTCCGGTTTCCGCGAGTGCCTG
::::::::::::::::::::::      :::::::::::::: :.:::::::::::::::::::::::::::::::::::::::.:::::::::::::::
GGAGCGAAGCCGGGTGGAGCCC------GTTCCCCGGTCCCCCGCCCAGGACGCCGAGGCGCTCGCCAGCTGCTACTTGTCCGGCTTCCGCGAGTGCCTG
--E--R--S--R--V--E--P--------V--P--R--S--P--A--Q--D--A--E--A--L--A--S--C--Y--L--S--G--F--R--E--C--L-

----------------------------------------------------------------------------------------------------
-L--R--L--A--A--F--A--H--D--A--S--P--A--A--R--A--Q--L--F--S--A--L--H--G--Y--L--R--P--K--P--P--R--P--
CTTCGCTTGGCGGCCTTCGCGCACGACGCCAGCCCGGCCGCCCGCGCCCAGCTCTTCTCCGCGCTGCACGGCTATCTGCGCCCCAAACCGCCCCGGCCCA
::::::.:::::::::::::::::::::::::   ::::::::::::::::::::::::::::                                     
CTTCGCCTGGCGGCCTTCGCGCACGACGCCAGAAAGGCCGCCCGCGCCCAGCTCTTCTCCGCG-------------------------------------
-L--R--L--A--A--F--A--H--D--A--R--K--A--A--R--A--Q--L--F--S--A--------------------------------------

----------------------------------------------------------------------------------------------------
K--P--V--D--P--R--P--P--A--P--R--P--S--L--D--P--A--A--P--A--L--G--P--A--L--H--Q--R--P--P--V--H--Q--G
AGCCGGTAGATCCGAGGCCTCCAGCGCCGCGCCCATCCCTGGACCCCGCCGCACCGGCCCTTGGCCCTGCGCTGCACCAGCGCCCCCCAGTGCACCAGGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--H--P--S--P--R--C--A--W--S--P--S--L--C--S--P--R--A--G--D--S--G--A--P--A--P--L--T--G--L--L--P--P--P-
CCACCCTAGCCCGCGCTGCGCATGGTCCCCATCCCTCTGCTCCCCGCGCGCCGGGGATTCTGGCGCGCCGGCGCCCCTCACCGGACTGCTGCCGCCGCCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------->
-P--P--P--H--R--Q--D--G--A--P--K--A--P--L--P--P--P--P--A--F--W--R--P--W--P--*-
CCGCCGCCTCACAGACAAGACGGGGCGCCCAAGGCCCCGCTGCCCCCGCCGCCCGCTTTCTGGAGACCTTGGCCCTGA
                                                                              
------------------------------------------------------------------------------
------------------------------------------------------------------------------

Pig Consensus Sequence

>BGISUST0000883795
----------------------------------------------------------------------------------------------------
--------------------------------------AACCTCCGGAACCCGAAGCTGGAGAAAGCAGAGATACTGGAGTTCGCCGTGGGCTACTTGAG
GGAGCGAAGCCGGGTGGAGCCC------GTTCCCCGGTCCCCCGCCCAGGACGCCGAGGCGCTCGCCAGCTGCTACTTGTCCGGCTTCCGCGAGTGCCTG
CTTCGCCTGGCGGCCTTCGCGCACGACGCCAGAAAGGCCGCCCGCGCCCAGCTCTTCTCCGCG-------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
------------------------------------------------------------------------------


>BGISUSP0000883795
----------------------------------------------NLRNPKLEKAEILEFAVGYLRERSRVEP--VPRSPAQDAEALASCYLSGFRECL
LRLAAFAHDARKAARAQLFSA-------------------------------------------------------------------------------
--------------------------