Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000178050 (click for geneview)
Transcript ID ENST00000318194(link to ensembl)
Symbol Q8NAQ6_HUMAN
Localtion Chromosome:11:118678084:118684068:1 band: 11q23.3
Description Cas-Br-M (murine) ecotropic retroviral transforming sequence (CBL), mRNA
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--P--R--G--W--W--I--V--K--D--G--Q--G--Y--I--F--D--C--L--G--I--L--W--I--Q--E--T--E--M--F--K--R--N--
ATGCCTAGAGGGTGGTGGATAGTGAAGGACGGTCAAGGTTATATTTTTGACTGCTTAGGGATTCTTTGGATCCAAGAAACAGAAATGTTCAAGCGGAATA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
K--G--G--S--G--V--V--V--R--M--Q--G--I--S--Q--N--P--G--R--E--V--P--L--V--L--G--W--S--W--N--C--R--A--L
AAGGAGGGAGTGGAGTTGTGGTAAGGATGCAGGGTATTTCGCAGAACCCAGGACGGGAAGTGCCTTTGGTTCTTGGGTGGAGCTGGAACTGCAGAGCTTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--H--L--V--L--S--P--A--S--Q--S--A--Y--G--I--C--G--P--Q--I--G--T--L--V--L--K--S--T--P--P--S--N--S--G-
GCACCTAGTCCTTTCTCCCGCTTCACAGTCTGCTTATGGTATATGTGGCCCCCAAATAGGCACTCTAGTCCTCAAGTCTACACCACCTTCCAACTCTGGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-D--H--H--E--Q--I--L--N--F--P--Y--L--I--F--F--F--F--E--M--E--S--R--C--V--A--Q--A--G--V--Q--W--C--S--
GATCACCATGAACAAATTCTCAATTTCCCATACTTAATTTTTTTTTTTTTTGAGATGGAGTCTCGCTGTGTCGCCCAGGCTGGAGTGCAGTGGTGCAGTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
L--N--S--P--Q--P--L--P--P--R--F--K--Q--F--S--A--S--T--S--R--V--A--G--I--T--G--A--C--H--H--A--Q--L--M
TCAACTCACCACAACCTCTGCCTCCCAGGTTCAAGCAGTTCTCTGCCTCAACCTCCCGAGTAGCTGGGATTACAGGCGCCTGCCACCATGCCCAGCTAAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------>
--F--I--F--L--V--E--T--G--F--H--R--L--G--*-
GTTCATATTTTTAGTAGAGACAGGGTTTCACCGTCTTGGCTAG
                                           
-------------------------------------------
-------------------------------------------