Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000175798 (click for geneview)
Transcript ID ENST00000318487(link to ensembl)
Localtion Chromosome:2:60873685:60874308:-1 band: 2p16.1
Description  
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-P--K--Y--R--D--Q--I--L--N--P--G--L--M--V--F--P--K--P--V--T--A--L--E--Y--A--F--S--R--S--D--L--T--S--
CCAAAATACCGTGACCAGATTCTTAACCCAGGACTGATGGTTTTTCCAAAACCAGTCACTGCATTGGAATATGCATTCAGTAGGTCTGATCTAACTTCGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
Y--A--G--Y--T--E--D--L--K--K--F--L--K--P--Y--T--L--E--E--Q--K--N--L--T--V--C--P--D--G--A--L--F--E--Q
ATGCAGGGTACACTGAAGACCTTAAGAAGTTTCTAAAACCATATACTTTAGAAGAACAGAAAAACCTCACAGTCTGTCCTGATGGAGCACTTTTTGAACA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--K--G--P--V--Y--V--A--C--Q--S--P--I--S--L--L--Q--A--C--R--G--M--N--D--L--D--F--G--Y--S--Q--R--N--P-
GAAGGGTCCAGTTTATGTTGCTTGTCAATCTCCCATTTCGTTACTTCAAGCATGCCGTGGTATGAATGATCTTGATTTCGGCTATTCTCAAAGAAACCCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-C--I--L--V--K--M--N--R--I--I--G--L--K--S--E--G--V--P--R--I--D--C--V--S--K--N--E--D--I--P--N--V--A--
TGTATTCTTGTGAAAATGAACAGAATAATTGGATTAAAGTCTGAAGGAGTGCCAAGGATAGATTGTGTTTCGAAGAATGAAGATATACCAAATGTAGCAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
V--Y--P--H--N--G--I--I--D--L--K--Y--F--P--Y--Y--G--E--K--L--H--V--G--Y--L--Q--P--L--V--A--V--Q--V--S
TTTATCCTCATAATGGAATTATAGACTTAAAATATTTCCCATATTATGGGGAAAAACTGCATGTGGGGTATCTACAGCCATTGGTTGCTGTTCAGGTCAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--F--A--P--N--D--T--G--K--E--V--T--V--E--C--K--I--D--G--S--A--N--L--K--S--Q--D--D--R--D--K--F--L--G-
CTTTGCTCCTAACGATACTGGGAAAGAAGTAACAGTTGAATGCAAGATTGATGGATCAGCCAACCTTAAAAGTCAGGATGATCGTGACAAGTTTTTGGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------->
-R--V--M--F--K--I--T--A-
CGAGTTATGTTCAAAATCACAGCA
                        
------------------------
------------------------