Sequences
EST Library Info
pliv1Unavailable
Clusters
Oligos
SNPs

Gene ID ENSG00000177459 (click for geneview)
Transcript ID ENST00000318528(link to ensembl)
Symbol NP_775820.1
Localtion Chromosome:8:99145926:99175014:1 band: 8q22.2
Description hypothetical protein FLJ39553
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<--------------------------------------------------------><-----------------------------------------
-M--G--C--S--S--S--A--L--N--K--A--G--D--S--S--R--F--P--S--V--T--S--N--E--H--F--S--T--A--E--E--S--E--
ATGGGCTGCTCCAGCAGCGCCCTCAACAAGGCCGGCGACAGCAGCAGGTTCCCCAGCGTAACTTCAAATGAGCATTTTTCAACTGCAGAAGAAAGTGAGT
                                                            :::::::::. :.::::::::::...::::::::::::::
------------------------------------------------------------ACTTCAAATACGTATTTTTCAACCATAGAAGAAAGTGAGT
-------------------------------------------------------------T--S--N--T--Y--F--S--T--I--E--E--S--E--

----------------------------------------------------------------------------------------------------
S--C--F--A--Q--P--K--P--H--A--L--G--R--E--S--T--V--D--G--N--V--Q--R--E--S--R--P--P--L--Q--K--L--K--V
CCTGCTTTGCCCAACCAAAGCCACATGCACTGGGAAGAGAATCTACTGTTGATGGCAATGTACAAAGGGAAAGCCGTCCTCCCTTACAAAAGCTCAAGGT
::::::: :.:::.:::::.::::.:..::::::::.:::::: ::: :  ::::: : :::::::.::.::::: :::::: .:: :::::::::::.:
CCTGCTTAGTCCAGCCAAAACCACGTATACTGGGAAAAGAATCGACTTTATATGGCCAGGTACAAAAGGGAAGCCTTCCTCCACTAGAAAAGCTCAAGAT
S--C--L--V--Q--P--K--P--R--I--L--G--K--E--S--T--L--Y--G--Q--V--Q--K--G--S--L--P--P--L--E--K--L--K--I

----------------------------------------------------------------------------------------------------
--S--A--E--P--T--A--N--G--V--K--P--L--Q--E--Q--P--L--A--K--D--V--A--P--G--R--D--A--T--D--Q--S--G--S-
TTCAGCAGAGCCTACAGCTAATGGTGTTAAACCCCTCCAAGAACAGCCCCTGGCCAAGGACGTAGCCCCTGGAAGGGATGCCACAGACCAATCAGGGTCC
::: :: : :.:::::::::::::::::                                                                        
TTCTGCTGTGTCTACAGCTAATGGTGTT------------------------------------------------------------------------
--S--A--V--S--T--A--N--G--V-------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-T--E--K--T--Q--P--G--E--G--L--E--E--S--G--P--P--Q--P--G--G--K--E--D--A--P--A--A--E--G--K--K--K--D--
ACAGAAAAGACTCAGCCTGGAGAGGGACTGGAGGAATCTGGGCCGCCTCAACCAGGTGGCAAAGAGGATGCCCCAGCAGCAGAAGGAAAGAAGAAAGATG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
A--G--A--G--T--E--A--E--S--L--K--G--N--A--E--A--Q--P--L--G--P--E--A--K--G--Q--P--L--Q--A--A--V--E--K
CAGGAGCAGGGACAGAGGCCGAGTCTCTAAAAGGAAATGCTGAAGCTCAGCCTTTAGGACCAGAAGCCAAGGGTCAGCCTTTGCAGGCAGCAGTAGAGAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--D--S--L--R--A--V--E--V--T--E--N--P--Q--T--A--A--E--M--K--P--L--G--T--T--E--N--V--L--T--L--Q--I--A-
GGACTCTCTCAGAGCAGTGGAGGTCACTGAGAATCCACAAACTGCTGCAGAGATGAAGCCTCTAGGAACAACTGAGAACGTTCTGACTCTGCAAATAGCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-G--E--L--Q--P--Q--G--T--V--G--K--D--E--Q--A--P--L--L--E--T--I--S--K--E--N--E--S--P--E--I--L--E--G--
GGAGAGCTACAACCTCAGGGCACAGTGGGAAAGGATGAGCAGGCCCCGCTTCTAGAAACAATTTCCAAAGAGAATGAATCTCCAGAAATATTGGAAGGAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
S--Q--F--V--E--T--A--E--E--Q--Q--L--Q--A--T--L--G--K--E--E--Q--P--Q--L--L--E--R--I--P--K--E--N--V--T
GTCAGTTTGTGGAAACAGCTGAAGAGCAGCAACTTCAGGCAACATTGGGAAAAGAGGAGCAGCCCCAGCTTCTAGAAAGAATTCCCAAAGAGAATGTAAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--P--E--V--L--D--R--S--Q--L--V--E--K--P--V--M--N--D--P--F--H--K--T--P--E--G--P--G--N--M--E--Q--I--Q-
ACCAGAAGTATTGGACAGAAGTCAGCTTGTGGAAAAGCCTGTTATGAATGATCCATTCCATAAAACTCCTGAAGGTCCAGGAAACATGGAGCAGATTCAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-P--E--G--I--V--G--S--M--E--H--P--A--R--N--V--E--A--G--A--Y--V--E--M--I--R--N--I--H--T--N--E--E--D--
CCTGAAGGAATAGTTGGAAGCATGGAGCATCCAGCACGAAATGTAGAGGCAGGAGCATATGTGGAAATGATCAGGAACATCCATACTAATGAAGAGGACC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------><---------------------------------------------------------------------------------------
Q--R--I--E--G--E--T--G--E--K--V--E--T--D--M--E--N--E--K--V--S--E--G--A--E--T--K--E--E--E--T--G--E--V
AACGCATTGAAGGTGAGACAGGGGAAAAGGTGGAAACAGACATGGAGAATGAGAAAGTGAGTGAAGGGGCTGAAACCAAAGAAGAAGAAACAGGAGAAGT
              ::::::::.:::::::: :::::::: ::::::.::::::::::.::::::::::::::::: ::::::::::::::::::::::.
--------------GAGACAGGAGAAAAGGTTGAAACAGAGATGGAGGATGAGAAAGTAAGTGAAGGGGCTGAAACAAAAGAAGAAGAAACAGGAGAAGC
---------------E--T--G--E--K--V--E--T--E--M--E--D--E--K--V--S--E--G--A--E--T--K--E--E--E--T--G--E--A

------------------------>
--V--D--L--S--A--A--T--*-
GGTGGACCTTTCAGCAGCCACATAG
 :::::.:: :::::::::::::::
TGTGGATCTGTCAGCAGCCACATAG
--V--D--L--S--A--A--T--*-

Pig Consensus Sequence

>BGISUST0000887531
------------------------------------------------------------ACTTCAAATACGTATTTTTCAACCATAGAAGAAAGTGAGT
CCTGCTTAGTCCAGCCAAAACCACGTATACTGGGAAAAGAATCGACTTTATATGGCCAGGTACAAAAGGGAAGCCTTCCTCCACTAGAAAAGCTCAAGAT
TTCTGCTGTGTCTACAGCTAATGGTGTT------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
--------------GAGACAGGAGAAAAGGTTGAAACAGAGATGGAGGATGAGAAAGTAAGTGAAGGGGCTGAAACAAAAGAAGAAGAAACAGGAGAAGC
TGTGGATCTGTCAGCAGCCACATAG


>BGISUSP0000887531
--------------------TSNTYFSTIEESESCLVQPKPRILGKESTLYGQVQKGSLPPLEKLKISAVSTANGV------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
--------------------------------------ETGEKVETEMEDEKVSEGAETKEEETGEAVDLSAAT*