Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000176349 (click for geneview)
Transcript ID ENST00000318959(link to ensembl)
Symbol Q8N997_HUMAN
Localtion Chromosome:7:1651463:1662808:1 band: 7p22.3
Description Hypothetical protein FLJ38166.
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--A--A--R--S--V--D--D--I--S--I--K--L--L--H--E--K--G--P--A--T--D--H--G--V--N--V--L--P--S--T--V--P--
ATGGCTGCACGCTCTGTAGATGACATCTCAATCAAGCTGCTTCATGAGAAAGGCCCAGCCACTGACCACGGGGTGAACGTCCTGCCATCCACAGTCCCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------><--------------------------------------------------------------------------
G--R--E--E--G--M--T--D--R--K--H--W--F--S--F--G--T--Q--P--N--V--P--G--L--Q--E--P--L--D--Y--R--A--A--N
GCCGAGAAGAAGGTATGACTGACAGGAAGCACTGGTTTTCTTTCGGGACACAACCGAACGTGCCAGGACTGCAGGAGCCGCTGGATTACAGAGCAGCAAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--Q--A--W--Q--A--V--L--A--E--V--P--R--G--G--P--G--C--A--A--L--R--D--L--G--R--C--G--G--P--D--V--S--T-
CCAGGCATGGCAGGCGGTGCTCGCGGAGGTACCACGGGGCGGACCAGGGTGTGCAGCGTTACGTGACTTGGGAAGATGTGGGGGGCCCGATGTATCTACC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-R--R--Q--W--R--P--L--P--F--S--C--P--L--S--H--T--T--Q--P--P--L--G--G--H--C--R--G--S--S--A--G--R--F--
AGGAGACAGTGGAGACCTCTACCCTTTAGCTGTCCTCTGTCCCACACAACCCAGCCCCCACTGGGCGGCCACTGCAGGGGAAGCTCAGCTGGAAGGTTCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
H--G--R--D--Q--T--S--P--G--T--V--Q--Q--L--P--S--A--H--V--L--K--P--G--C--T--Q--H--G--D--L--S--P--G--Q
ATGGGAGAGACCAGACCAGTCCTGGCACTGTCCAGCAGCTGCCTTCGGCCCATGTTCTGAAACCGGGATGCACACAGCATGGAGATCTCAGCCCTGGGCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--A--S--P--P--P--A--A--A--L--G--P--S--P--K--A--W--T--H--T--L--G--R--P--Q--L--W--A--G--L--G--S--H--R-
GGCCTCGCCCCCTCCAGCAGCTGCCCTCGGCCCATCTCCCAAAGCCTGGACGCATACACTGGGGAGACCTCAGCTCTGGGCAGGCCTGGGTTCCCATCGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------->
-F--G--V--P--G--P--G--T--R--N--T--L--A--A--C--C--V--Q--E--*-
TTCGGCGTCCCTGGGCCCGGGACACGGAACACACTTGCTGCGTGCTGTGTACAAGAATGA
                                                            
------------------------------------------------------------
------------------------------------------------------------