Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000179477 (click for geneview)
Transcript ID ENST00000319144(link to ensembl)
Symbol ALOX12B
Localtion Chromosome:17:7916710:7931746:-1 band: 17p13.1
Description Arachidonate 12-lipoxygenase, 12R type (EC 1.13.11.-) (Epidermis-type lipoxygenase 12) (12R-lipoxygenase) (12R-LOX). [Source:Uniprot/SWISSPROT;Acc:O75342]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--A--T--Y--K--V--R--V--A--T--G--T--D--L--L--S--G--T--R--D--S--I--S--L--T--I--V--G--T--Q--G--E--S--
ATGGCCACCTACAAAGTCAGGGTGGCCACAGGCACCGACCTCTTGTCGGGAACACGGGACTCCATCTCACTGACCATTGTGGGGACACAAGGAGAGAGCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------><----------------------------------------------------
H--K--Q--L--L--N--H--F--G--R--D--F--A--T--G--A--V--G--Q--Y--T--V--Q--C--P--Q--D--L--G--E--L--I--I--I
ATAAGCAGCTGCTGAACCACTTTGGGAGAGACTTTGCAACTGGGGCGGTGGGCCAGTACACCGTGCAGTGCCCTCAGGACCTGGGTGAGCTCATCATCAT
                                               ::::.: ::::::: :: :.:::::  ::::::::::: ::::::::::::::
-----------------------------------------------GTGGACGAGTACACGGTCCGGTGCCAGCAGGACCTGGGGGAGCTCATCATCAT
------------------------------------------------V--D--E--Y--T--V--R--C--Q--Q--D--L--G--E--L--I--I--I

----------------------------------------------------------------------------------------------------
--R--L--H--K--E--R--Y--A--F--F--P--K--D--P--W--Y--C--N--Y--V--Q--I--C--A--P--N--G--R--I--Y--H--F--P-
CCGCCTGCACAAAGAGCGGTACGCCTTCTTCCCCAAGGACCCTTGGTACTGCAACTATGTGCAGATCTGTGCCCCCAACGGCCGTATCTACCACTTCCCC
::: :::.:: :.::::: ::. :.:..:::::::::.::.:.:::::::::                                                
CCGACTGTACCAGGAGCGCTATCCTTCTTTCCCCAAGAACTCCTGGTACTGC------------------------------------------------
--R--L--Y--Q--E--R--Y--P--S--F--P--K--N--S--W--Y--C-------------------------------------------------

---------------------------------------------------><-----------------------------------------------
-A--Y--Q--W--M--D--G--Y--E--T--L--A--L--R--E--A--T--G--K--T--T--A--D--D--S--L--P--V--L--L--E--H--R--
GCCTACCAGTGGATGGATGGCTACGAGACCCTGGCACTCCGGGAGGCCACAGGAAAGACAACAGCAGATGACTCGCTCCCCGTCCTCCTGGAGCACAGAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------><-----------------------------------------------------------------
K--E--E--I--R--A--K--Q--D--F--Y--H--W--R--V--F--L--P--G--L--P--S--Y--V--H--I--P--S--Y--R--P--P--V--R
AAGAGGAGATCAGAGCCAAGCAGGACTTCTACCACTGGCGAGTCTTTCTTCCTGGCCTGCCCAGCTATGTGCACATTCCCAGTTACCGCCCTCCGGTGCG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------><------------------------------------------------------------------------
--R--H--R--N--P--N--R--P--E--W--N--G--Y--I--P--G--F--P--I--L--I--N--F--K--A--T--K--F--L--N--L--N--L-
GAGGCATCGCAACCCCAACCGGCCTGAGTGGAATGGCTATATTCCGGGATTCCCAATTCTCATCAACTTTAAGGCCACCAAGTTCCTGAACTTAAATCTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------><-------------------------------------------------
-R--Y--S--F--L--K--T--A--S--F--F--V--R--L--G--P--M--A--L--A--F--K--V--R--G--L--L--D--C--K--H--S--W--
CGCTACTCCTTCCTCAAGACGGCCTCCTTCTTCGTCCGCCTGGGGCCCATGGCACTGGCTTTCAAAGTCCGCGGCCTGTTGGACTGCAAACATTCGTGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------------><---------------------------------------------
K--R--L--K--D--I--R--K--I--F--P--G--K--K--S--V--V--S--E--Y--V--A--E--H--W--A--E--D--T--F--F--G--Y--Q
AGAGGCTGAAGGACATTAGGAAAATTTTCCCTGGCAAGAAATCTGTCGTCTCCGAGTACGTGGCCGAGCACTGGGCAGAGGACACCTTCTTTGGGTACCA
                                                        :::::: :::::::::::.::::::::: :::::::::::::::
--------------------------------------------------------TACGTGTCCGAGCACTGGACAGAGGACAGCTTCTTTGGGTACCA
---------------------------------------------------------Y--V--S--E--H--W--T--E--D--S--F--F--G--Y--Q

----------------------------------------------------------------------------------------------------
--Y--L--N--G--V--N--P--G--L--I--R--R--C--T--R--I--P--D--K--F--P--V--T--D--D--M--V--A--P--F--L--G--E-
GTACCTCAACGGCGTCAACCCCGGCCTGATCCGCCGCTGCACGCGGATCCCAGACAAGTTCCCCGTCACAGACGACATGGTGGCTCCGTTCCTGGGCGAG
:::::: ::.::::::::::: :::::: :::::::::::::::::::.:::::::::::::: ::::::::::::::::::::.:::::::::::::::
GTACCTGAATGGCGTCAACCCGGGCCTGCTCCGCCGCTGCACGCGGATTCCAGACAAGTTCCCGGTCACAGACGACATGGTGGCCCCGTTCCTGGGCGAG
--Y--L--N--G--V--N--P--G--L--L--R--R--C--T--R--I--P--D--K--F--P--V--T--D--D--M--V--A--P--F--L--G--E-

--------------------------><------------------------------------------------------------------------
-G--T--C--L--Q--A--E--L--E--K--G--N--I--Y--L--A--D--Y--R--I--M--E--G--I--P--T--V--E--L--S--G--R--K--
GGAACGTGCTTGCAAGCGGAGCTGGAGAAGGGGAACATTTACCTGGCCGACTACCGCATCATGGAGGGCATCCCCACCGTGGAGCTCAGCGGCCGGAAGC
:::::::::.::::::: ::::::::::::::::::::::::::::: :::::::::::: :::::::::::::::: :: ::.::::.:::::::::::
GGAACGTGCCTGCAAGCCGAGCTGGAGAAGGGGAACATTTACCTGGCAGACTACCGCATCTTGGAGGGCATCCCCACGGTTGAACTCAACGGCCGGAAGC
-G--T--C--L--Q--A--E--L--E--K--G--N--I--Y--L--A--D--Y--R--I--L--E--G--I--P--T--V--E--L--N--G--R--K--

----------------------------------------------------------------------><----------------------------
Q--H--H--C--A--P--L--C--L--L--H--F--G--P--E--G--K--M--M--P--I--A--I--Q--L--S--Q--T--P--G--P--D--C--P
AGCACCACTGCGCCCCCCTCTGCCTGCTGCACTTTGGACCCGAGGGCAAGATGATGCCCATCGCCATCCAGCTCAGCCAGACCCCTGGGCCAGATTGCCC
::::::::::::::::::::::::::::::::::::: :: ::.:: ::  ::::::::::::::::::::::::::::::::::.::::: ::.:::::
AGCACCACTGCGCCCCCCTCTGCCTGCTGCACTTTGGCCCGGAAGGGAACCTGATGCCCATCGCCATCCAGCTCAGCCAGACCCCCGGGCCCGACTGCCC
Q--H--H--C--A--P--L--C--L--L--H--F--G--P--E--G--N--L--M--P--I--A--I--Q--L--S--Q--T--P--G--P--D--C--P

----------------------------------------------------------------------------------------------------
--I--F--L--P--S--D--S--E--W--D--W--L--L--A--K--T--W--V--R--Y--A--E--F--Y--S--H--E--A--I--A--H--L--L-
CATCTTCCTGCCCAGTGATTCTGAGTGGGACTGGCTGCTAGCCAAGACGTGGGTACGCTATGCGGAGTTCTACAGCCACGAGGCCATCGCCCACCTGCTG
:::::::::::::::.::.::::::::::::::::::::.::::::::::::::.:::::.:: :::::::::::::::                     
CATCTTCCTGCCCAGCGACTCTGAGTGGGACTGGCTGCTGGCCAAGACGTGGGTGCGCTACGCCGAGTTCTACAGCCAC---------------------
--I--F--L--P--S--D--S--E--W--D--W--L--L--A--K--T--W--V--R--Y--A--E--F--Y--S--H----------------------

--------------------------------------------------------------------------><------------------------
-E--T--H--L--I--A--E--A--F--C--L--A--L--L--R--N--L--P--M--C--H--P--L--Y--K--L--L--I--P--H--T--R--Y--
GAGACACACCTCATTGCTGAGGCCTTCTGCCTGGCCTTGCTGAGGAACCTGCCCATGTGCCACCCCCTCTACAAGCTCCTCATCCCCCATACCCGATACA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------><-------------------------------------
T--V--Q--I--N--S--I--G--R--A--V--L--L--N--E--G--G--L--S--A--K--G--M--S--L--G--V--E--G--F--A--G--V--M
CCGTCCAGATCAACAGCATTGGCCGGGCCGTTCTCCTCAATGAGGGGGGGCTCTCTGCCAAGGGCATGTCCCTGGGCGTGGAAGGCTTTGCTGGGGTGAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--V--R--A--L--S--E--L--T--Y--D--S--L--Y--L--P--N--D--F--V--E--R--G--V--Q--D--L--P--G--Y--Y--Y--R--D-
GGTACGGGCTCTGTCGGAGCTCACCTATGACAGCCTCTACCTCCCCAATGACTTTGTGGAGCGTGGGGTCCAGGACCTGCCTGGATATTACTACCGCGAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------><-------------------------------------------------------------------
-D--S--L--A--V--W--N--A--L--E--K--Y--V--T--E--I--I--T--Y--Y--Y--P--S--D--A--A--V--E--G--D--P--E--L--
GACAGCTTGGCGGTGTGGAATGCACTGGAGAAGTATGTGACGGAGATCATCACCTATTATTACCCGAGTGACGCAGCCGTGGAGGGTGATCCGGAATTGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------------><---------------------------------------------
Q--S--W--V--Q--E--I--F--K--E--C--L--L--G--R--E--S--S--G--F--P--R--C--L--R--T--V--P--E--L--I--R--Y--V
AGTCTTGGGTGCAGGAAATATTTAAAGAGTGCCTCCTGGGGCGGGAGAGCTCAGGCTTCCCTAGGTGCTTGCGAACCGTGCCTGAGCTGATCCGATATGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------><--------------------------------------------
--T--I--V--I--Y--T--C--S--A--K--H--A--A--V--N--T--G--Q--M--E--F--T--A--W--M--P--N--F--P--A--S--M--R-
CACTATAGTCATCTACACCTGCTCTGCCAAGCACGCTGCTGTCAACACAGGCCAGATGGAGTTCACCGCCTGGATGCCCAACTTCCCAGCGTCCATGCGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-N--P--P--I--Q--T--K--G--L--T--T--L--E--T--F--M--D--T--L--P--D--V--K--T--T--C--I--T--L--L--V--L--W--
AATCCACCGATTCAGACTAAGGGGCTGACCACTCTGGAGACCTTCATGGACACGTTGCCGGATGTGAAGACCACGTGCATCACGCTGCTGGTGCTCTGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------><-------------------------------------------------------------------------
T--L--S--R--E--P--D--D--R--R--P--L--G--H--F--P--D--I--H--F--V--E--E--A--P--R--R--S--I--E--A--F--R--Q
CCCTCAGCCGAGAGCCTGACGACAGGCGGCCCCTGGGACACTTCCCGGACATTCACTTCGTGGAGGAGGCCCCGCGGAGGAGCATAGAGGCGTTCCGCCA
                          ::::::::::: :::::::: :::::.::::::::::::::::: ::::::::::::::::::.: ::::::::
--------------------------CGGCCCCTGGGCCACTTCCCCGACATCCACTTCGTGGAGGAGGCGCCGCGGAGGAGCATAGAGACCTTCCGCCA
---------------------------R--P--L--G--H--F--P--D--I--H--F--V--E--E--A--P--R--R--S--I--E--T--F--R--Q

----------------------------------------------------------------------------------------------------
--R--L--N--Q--I--S--H--D--I--R--Q--R--N--K--C--L--P--I--P--Y--Y--Y--L--D--P--V--L--I--E--N--S--I--S-
GCGCCTGAACCAGATCTCACACGACATCCGCCAGCGCAACAAGTGCCTTCCCATCCCCTACTACTACCTGGACCCGGTGCTGATTGAGAACAGCATTTCT
:::::::  :::::::::.::: :::::::::::::::::::::::::.:::::::::::::::::::::::::: ::::::::.:::::::::::.::.
GCGCCTGTCCCAGATCTCGCACCACATCCGCCAGCGCAACAAGTGCCTCCCCATCCCCTACTACTACCTGGACCCCGTGCTGATCGAGAACAGCATCTCC
--R--L--S--Q--I--S--H--H--I--R--Q--R--N--K--C--L--P--I--P--Y--Y--Y--L--D--P--V--L--I--E--N--S--I--S-

----->
-I--*-
ATTTAG
::.:::
ATCTAG
-I--*-

Pig Consensus Sequence

>BGISUST0000882907
----------------------------------------------------------------------------------------------------
-----------------------------------------------GTGGACGAGTACACGGTCCGGTGCCAGCAGGACCTGGGGGAGCTCATCATCAT
CCGACTGTACCAGGAGCGCTATCCTTCTTTCCCCAAGAACTCCTGGTACTGC------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
--------------------------------------------------------TACGTGTCCGAGCACTGGACAGAGGACAGCTTCTTTGGGTACCA
GTACCTGAATGGCGTCAACCCGGGCCTGCTCCGCCGCTGCACGCGGATTCCAGACAAGTTCCCGGTCACAGACGACATGGTGGCCCCGTTCCTGGGCGAG
GGAACGTGCCTGCAAGCCGAGCTGGAGAAGGGGAACATTTACCTGGCAGACTACCGCATCTTGGAGGGCATCCCCACGGTTGAACTCAACGGCCGGAAGC
AGCACCACTGCGCCCCCCTCTGCCTGCTGCACTTTGGCCCGGAAGGGAACCTGATGCCCATCGCCATCCAGCTCAGCCAGACCCCCGGGCCCGACTGCCC
CATCTTCCTGCCCAGCGACTCTGAGTGGGACTGGCTGCTGGCCAAGACGTGGGTGCGCTACGCCGAGTTCTACAGCCAC---------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
--------------------------CGGCCCCTGGGCCACTTCCCCGACATCCACTTCGTGGAGGAGGCGCCGCGGAGGAGCATAGAGACCTTCCGCCA
GCGCCTGTCCCAGATCTCGCACCACATCCGCCAGCGCAACAAGTGCCTCCCCATCCCCTACTACTACCTGGACCCCGTGCTGATCGAGAACAGCATCTCC
ATCTAG


>BGISUSP0000882907
-------------------------------------------------VDEYTVRCQQDLGELIIIRLYQERYPSFPKNSWYC----------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------YVSEHWTEDSFFGYQYLNGVNPGLLRRCTRIPDKFPVTDDMVAPFLGE
GTCLQAELEKGNIYLADYRILEGIPTVELNGRKQHHCAPLCLLHFGPEGNLMPIAIQLSQTPGPDCPIFLPSDSEWDWLLAKTWVRYAEFYSH-------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
------------------------------------------RPLGHFPDIHFVEEAPRRSIETFRQRLSQISHHIRQRNKCLPIPYYYLDPVLIENSIS
I*