Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000177108 (click for geneview)
Transcript ID ENST00000319374(link to ensembl)
Symbol ZDHHC22
Localtion Chromosome:14:76669804:76675834:-1 band: 14q24.3
Description zinc finger, DHHC domain containing 22 [Source:RefSeq_peptide;Acc:NP_777636]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--L--A--L--R--L--L--N--V--V--A--P--A--Y--F--L--C--I--S--L--V--T--F--V--L--Q--L--F--L--F--L--P--S--
ATGCTGGCCCTGCGGCTGCTCAACGTGGTGGCCCCCGCCTACTTCTTGTGCATCTCCCTGGTGACCTTCGTGCTGCAGCTCTTCCTCTTCCTGCCCAGCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
M--R--E--D--P--A--A--A--R--L--F--S--P--A--L--L--H--G--A--L--F--L--F--L--S--A--N--A--L--G--N--Y--V--L
TGCGCGAGGACCCCGCGGCCGCCCGGCTCTTCTCGCCCGCCCTGCTCCACGGGGCGCTCTTCCTATTCCTCTCGGCCAACGCCCTGGGCAATTACGTCCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--V--I--Q--N--S--P--D--D--L--G--A--C--Q--G--A--S--A--R--K--T--P--C--P--S--P--S--T--H--F--C--R--V--C-
TGTCATCCAGAACTCCCCAGACGACCTGGGGGCCTGCCAGGGGGCCTCGGCCAGGAAGACTCCATGCCCCTCACCTAGCACCCACTTCTGCCGAGTGTGC
                                                                         ::.::::::::::::::::::::::::
-------------------------------------------------------------------------CCCAGCACCCACTTCTGCCGAGTGTGC
--------------------------------------------------------------------------P--S--T--H--F--C--R--V--C-

----------------------------------------------------------------------------------------------------
-A--R--V--T--L--R--H--D--H--H--C--F--F--T--G--N--C--I--G--S--R--N--M--R--N--F--V--L--F--C--L--Y--T--
GCCAGAGTCACCCTGAGGCACGACCATCACTGTTTCTTCACCGGCAACTGCATCGGCAGCAGGAACATGCGCAACTTCGTCCTGTTCTGCCTCTACACCT
::::::::::::::::::::::::::::::::.::::::::.:::::::::::::: :::::::::::::::::::::::::::::::::::::::::::
GCCAGAGTCACCCTGAGGCACGACCATCACTGCTTCTTCACTGGCAACTGCATCGGGAGCAGGAACATGCGCAACTTCGTCCTGTTCTGCCTCTACACCT
-A--R--V--T--L--R--H--D--H--H--C--F--F--T--G--N--C--I--G--S--R--N--M--R--N--F--V--L--F--C--L--Y--T--

-------><-----------><--------------------------------------------------------->
S--L--A--P--L--L--H--G--L--R--K--E--V--A--A--G--P--A--G--P--H--V--Q--C--R--K--*-
CCCTGGCCCCTCTACTCCATGGTCTTCGGAAAGAGGTGGCTGCTGGGCCTGCTGGTCCCCATGTTCAATGTCGGAAGTGA
::::::::                                                                        
CCCTGGCC------------------------------------------------------------------------
S--L--A-------------------------------------------------------------------------

Pig Consensus Sequence

>BGISUST0000884882
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
-------------------------------------------------------------------------CCCAGCACCCACTTCTGCCGAGTGTGC
GCCAGAGTCACCCTGAGGCACGACCATCACTGCTTCTTCACTGGCAACTGCATCGGGAGCAGGAACATGCGCAACTTCGTCCTGTTCTGCCTCTACACCT
CCCTGGCC------------------------------------------------------------------------


>BGISUSP0000884882
-------------------------------------------------------------------------------------------PSTHFCRVC
ARVTLRHDHHCFFTGNCIGSRNMRNFVLFCLYTSLA------------------------