Sequences
EST Library Info
tes3Testes
Clusters
Oligos
SNPs

Gene ID ENSG00000175664 (click for geneview)
Transcript ID ENST00000320096(link to ensembl)
Symbol NP_689538.1
Localtion Chromosome:13:30404834:30447151:1 band: 13q12.3
Description hypothetical protein MGC40178
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-----------------------------------------------------------><--------------------------------------
-M--E--Q--P--G--P--R--A--P--D--P--S--L--C--H--H--N--L--Q--P--T--D--D--P--N--W--D--S--Y--A--T--T--M--
ATGGAACAGCCTGGGCCCAGGGCTCCGGATCCCTCTCTCTGCCACCACAACCTCCAGCCAACAGATGACCCCAACTGGGATTCCTATGCTACCACTATGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------><-----------------------------------------------------
R--T--A--F--T--P--K--T--G--A--V--P--A--L--I--R--Q--N--G--I--R--R--L--G--Y--T--Y--S--L--S--D--P--I--L
GGACTGCATTCACGCCTAAAACAGGAGCAGTGCCTGCCTTAATTCGCCAAAACGGTATCAGAAGATTAGGATATACATATTCACTTAGTGATCCTATTCT
                                               ::::: .:::.::::::::: ::::::.::::.::::::::::::::.::::.
-----------------------------------------------CAAAAAAGTACCAGAAGATTTGGATATGCATACTCACTTAGTGATCCCATTCC
------------------------------------------------Q--K--S--T--R--R--F--G--Y--A--Y--S--L--S--D--P--I--P

----------------------------------------------------------------------------------------------------
--N--Q--T--Q--Y--S--D--E--Y--T--W--K--S--H--S--K--E--D--L--I--K--T--E--T--S--R--G--I--K--S--H--K--S-
CAATCAGACACAATATAGTGATGAGTACACTTGGAAATCACACTCTAAAGAAGATTTGATCAAAACTGAGACTTCAAGAGGAATCAAGAGCCACAAATCT
::::::::::::.::.:..::::::::...::::::: ::.:.:: ::::::::::...:::: ::::.:::::::::::::.::::::: :: ::::.:
CAATCAGACACAGTACAACGATGAGTATGTTTGGAAAGCATATTCGAAAGAAGATTCAGTCAACACTGGGACTTCAAGAGGAGTCAAGAGGCAGAAATTT
--N--Q--T--Q--Y--N--D--E--Y--V--W--K--A--Y--S--K--E--D--S--V--N--T--G--T--S--R--G--V--K--R--Q--K--F-

-----------><---------------------------------------------------------------------------------------
-H--L--N--E--D--I--F--L--W--T--L--P--H--C--Q--Q--T--G--T--L--K--N--C--L--P--W--K--I--P--A--S--M--K--
CATCTCAATGAAGACATTTTCCTGTGGACACTACCTCACTGTCAACAAACGGGGACACTAAAGAACTGCCTCCCTTGGAAAATCCCGGCTTCAATGAAAG
::.                                                                                                 
CAC-------------------------------------------------------------------------------------------------
-H--------------------------------------------------------------------------------------------------

--------------------------------------------------------------------><------------------------------
E--V--N--K--A--L--S--N--Q--F--I--S--L--T--K--R--D--F--V--D--R--S--K--A--Q--K--I--K--K--S--S--H--L--S
AAGTTAACAAGGCACTATCAAATCAGTTTATTTCCCTTACTAAGAGAGACTTTGTGGACAGATCAAAAGCTCAGAAGATTAAGAAAAGTTCTCACTTGTC
                                                                       :::::::::::: :: .::::::  :::.
-----------------------------------------------------------------------CAGAAGATTAAGCAACATTCTCAGATGTT
------------------------------------------------------------------------Q--K--I--K--Q--H--S--Q--M--F

----------------------------------------------------------------------------------------------------
--L--E--W--K--K--L--L--P--Q--P--P--D--T--E--F--R--R--N--Y--Q--I--P--A--K--I--P--E--L--Q--D--F--S--F-
TCTGGAATGGAAAAAGTTACTTCCCCAACCTCCAGACACTGAATTCCGAAGGAATTACCAAATTCCAGCTAAAATTCCTGAGCTTCAAGATTTCAGTTTC
:..:::::::::::::::::::::::: ::: :::::::::::::.::: :.:::::::::::::::::::::::::::::.:::::.:::::.::::::
TTCGGAATGGAAAAAGTTACTTCCCCATCCTGCAGACACTGAATTTCGACGAAATTACCAAATTCCAGCTAAAATTCCTGAACTTCAGGATTTTAGTTTC
--S--E--W--K--K--L--L--P--H--P--A--D--T--E--F--R--R--N--Y--Q--I--P--A--K--I--P--E--L--Q--D--F--S--F-

---------------------------------------------><-----------------------------------------------------
-K--Y--G--C--Y--S--S--L--P--V--A--S--Q--G--L--V--P--S--V--L--H--S--Y--L--R--N--Q--E--H--T--K--K--Q--
AAATATGGATGCTACTCAAGCTTGCCTGTTGCTTCTCAGGGTCTAGTGCCTTCTGTGCTGCACAGCTACCTGAGGAACCAAGAGCACACAAAGAAACAGA
::::::::::::::.::::::.:.::..:::: ::: ::::::::   :::::.::::::::::::.:: :::::::::::::::.:::::::::.::::
AAATATGGATGCTATTCAAGCCTACCCATTGCGTCTAAGGGTCTA---CCTTCCGTGCTGCACAGCCACATGAGGAACCAAGAGCGCACAAAGAAGCAGA
-K--Y--G--C--Y--S--S--L--P--I--A--S--K--G--L-----P--S--V--L--H--S--H--M--R--N--Q--E--R--T--K--K--Q--

----------------------------------------------------------------------------------------------------
T--T--Y--Q--S--D--Y--D--K--T--Y--P--D--F--L--M--L--L--N--S--F--T--S--S--Q--V--K--E--Y--L--Q--S--L--S
CCACATACCAAAGTGACTACGACAAAACCTACCCAGATTTCTTAATGCTTTTAAACTCATTTACTTCCTCTCAAGTCAAAGAGTACCTTCAGAGTCTTTC
::::::::::.:::::.::::. :::.:::..:..::::::::::.. ::::.::::::::::::.::::::::.::: :::::::::::::::  ::::
CCACATACCAGAGTGATTACGGGAAAGCCTGTCTGGATTTCTTAACAGTTTTGAACTCATTTACTCCCTCTCAAATCACAGAGTACCTTCAGAGAGTTTC
T--T--Y--Q--S--D--Y--G--K--A--C--L--D--F--L--T--V--L--N--S--F--T--P--S--Q--I--T--E--Y--L--Q--R--V--S

-------><------------------------------------------------------------>
--Y--K--D--R--Q--I--I--D--R--F--I--R--T--H--C--D--T--N--K--K--K--K--*-
CTACAAAGATAGACAAATTATTGATCGCTTTATTCGTACTCACTGTGACACTAACAAAAAGAAGAAATGA
:.:::::                                                               
CCACAAA---------------------------------------------------------------
--H--K----------------------------------------------------------------

Pig Consensus Sequence

>BGISUST0000901783
----------------------------------------------------------------------------------------------------
-----------------------------------------------CAAAAAAGTACCAGAAGATTTGGATATGCATACTCACTTAGTGATCCCATTCC
CAATCAGACACAGTACAACGATGAGTATGTTTGGAAAGCATATTCGAAAGAAGATTCAGTCAACACTGGGACTTCAAGAGGAGTCAAGAGGCAGAAATTT
CAC-------------------------------------------------------------------------------------------------
-----------------------------------------------------------------------CAGAAGATTAAGCAACATTCTCAGATGTT
TTCGGAATGGAAAAAGTTACTTCCCCATCCTGCAGACACTGAATTTCGACGAAATTACCAAATTCCAGCTAAAATTCCTGAACTTCAGGATTTTAGTTTC
AAATATGGATGCTATTCAAGCCTACCCATTGCGTCTAAGGGTCTA---CCTTCCGTGCTGCACAGCCACATGAGGAACCAAGAGCGCACAAAGAAGCAGA
CCACATACCAGAGTGATTACGGGAAAGCCTGTCTGGATTTCTTAACAGTTTTGAACTCATTTACTCCCTCTCAAATCACAGAGTACCTTCAGAGAGTTTC
CCACAAA---------------------------------------------------------------


>BGISUSP0000901783
-------------------------------------------------QKSTRRFGYAYSLSDPIPNQTQYNDEYVWKAYSKEDSVNTGTSRGVKRQKF
H--------------------------------------------------------QKIKQHSQMFSEWKKLLPHPADTEFRRNYQIPAKIPELQDFSF
KYGCYSSLPIASKGL-PSVLHSHMRNQERTKKQTTYQSDYGKACLDFLTVLNSFTPSQITEYLQRVSHK---------------------