Sequences
EST Library Info
nep1Newborn 115 days, epidermis
plac1Unavailable
Clusters
Oligos
SNPs

Gene ID ENSG00000111973 (click for geneview)
Transcript ID ENST00000320994(link to ensembl)
Symbol LY6G6E
Localtion Chromosome:6:31788092:31789568:-1 band: 6p21.33
Description lymphocyte antigen 6 complex G6E [Source:RefSeq_peptide;Acc:NP_077028]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<--------------------------------------------------><-----------------------------------------------
-M--G--T--S--S--I--F--L--C--V--L--F--L--C--G--A--L--G--L--T--M--S--P--A--R--G--R--L--R--C--Y--I--C--
ATGGGCACCTCCAGCATCTTCCTCTGCGTGCTGTTCCTCTGTGGGGCACTGGGTCTCACCATGTCCCCTGCCCGGGGAAGGCTCCGCTGCTACATCTGTG
::::::::::::::::::::::::::: : ::::::::  :::::::::::                                                 
ATGGGCACCTCCAGCATCTTCCTCTGCCTTCTGTTCCTGGGTGGGGCACTG-------------------------------------------------
-M--G--T--S--S--I--F--L--C--L--L--F--L--G--G--A--L--------------------------------------------------

-----------------------------------------------------------------------------><---------------------
G--F--T--K--P--C--H--P--V--P--T--E--C--R--D--D--E--A--C--G--I--S--I--G--T--S--V--K--K--L--P--L--K--G
GCTTCACCAAACCCTGCCACCCTGTTCCCACCGAGTGTCGGGACGATGAAGCTTGTGGCATCAGTATTGGCACTTCAGTGAAAAAGCTGCCTCTCAAGGG
                                                                                .:::.::::::::.::::::
--------------------------------------------------------------------------------GAAAGGCTGCCTCCCAAGGG
---------------------------------------------------------------------------------E--R--L--P--P--K--G

----------------------------------------------------------------------------------------------------
--P--V--P--S--A--R--L--C--H--L--L--A--A--L--L--H--S--V--A--P--L--L--R--A--G--P--V--Q--H--S--R--F--P-
CCCAGTGCCCTCTGCCAGGCTATGCCACCTACTGGCTGCACTCCTACACTCTGTGGCACCACTGCTGCGAGCAGGACCTGTGCAACATAGCCGCTTCCCC
::::::::::::::: .:::::::.::::::::::.:.:.:::::::.:::::.:::::::::::::.:::::::::::::::::: .:::         
CCCAGTGCCCTCTGCAGGGCTATGTCACCTACTGGTTACGCTCCTACGCTCTGCGGCACCACTGCTGTGAGCAGGACCTGTGCAACTCAGC---------
--P--V--P--S--A--G--L--C--H--L--L--V--T--L--L--R--S--A--A--P--L--L--*--A--G--P--V--Q--L--S----------

----------------------------------------------------------------------------------->
-T--A--A--H--Q--P--P--R--L--P--A--P--L--C--G--Q--L--R--W--E--R--T--P--P--P--L--A--S-
ACAGCAGCTCACCAGCCTCCTCGCCTCCCTGCCCCTCTTTGTGGCCAGCTTCGCTGGGAGAGGACACCTCCTCCACTAGCTTCC
                                                                                    
------------------------------------------------------------------------------------
------------------------------------------------------------------------------------

Pig Consensus Sequence

>BGISUST0000898932
ATGGGCACCTCCAGCATCTTCCTCTGCCTTCTGTTCCTGGGTGGGGCACTG-------------------------------------------------
--------------------------------------------------------------------------------GAAAGGCTGCCTCCCAAGGG
CCCAGTGCCCTCTGCAGGGCTATGTCACCTACTGGTTACGCTCCTACGCTCTGCGGCACCACTGCTGTGAGCAGGACCTGTGCAACTCAGC---------
------------------------------------------------------------------------------------


>BGISUSP0000898932
MGTSSIFLCLLFLGGAL-------------------------------------------ERLPPKGPVPSAGLCHLLVTLLRSAAPLL*AGPVQLS---
----------------------------