Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000181323 (click for geneview)
Transcript ID ENST00000323675(link to ensembl)
Symbol Q8N4L4_HUMAN
Localtion Chromosome:17:7264403:7265674:1 band: 17p13.1
Description LOC374768 protein.
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--A--M--V--E--R--P--R--P--E--W--A--S--Y--H--N--C--N--S--N--S--C--Q--D--L--G--N--S--V--L--L--L--L--
ATGGCCATGGTTGAGCGGCCGAGGCCCGAGTGGGCCTCGTATCACAACTGCAACAGCAACAGCTGCCAGGACCTGGGCAACTCTGTCCTGTTGCTGCTGG
::::::::::.:::::::::  ::::::.:::::::::.:::::::.:. ::::: :::::::::::::::::::::::.:::..:::::.:::::::::
ATGGCCATGGCTGAGCGGCCCCGGCCCGGGTGGGCCTCATATCACAGCCCCAACACCAACAGCTGCCAGGACCTGGGCAGCTCCATCCTGCTGCTGCTGG
-M--A--M--A--E--R--P--R--P--G--W--A--S--Y--H--S--P--N--T--N--S--C--Q--D--L--G--S--S--I--L--L--L--L--

-------------------------------------------><-------------------------------------------------------
G--L--I--I--C--I--N--I--S--I--N--I--V--T--L--L--W--S--R--F--R--G--V--L--Y--Q--V--F--H--D--T--I--C--E
GCCTCATCATCTGCATTAACATTAGCATCAATATAGTGACCCTGCTCTGGAGCCGATTCCGTGGTGTCTTATACCAAGTGTTCCATGATACCATTTGTGA
:::::::::::::::::::::::.::::::::::.::::: :::                                                        
GCCTCATCATCTGCATTAACATTGGCATCAATATGGTGACGCTG--------------------------------------------------------
G--L--I--I--C--I--N--I--G--I--N--M--V--T--L---------------------------------------------------------

----><----------------------------------------------------------------------------------------------
--K--E--A--P--K--S--S--L--L--R--K--Q--T--Q--P--P--K--K--Q--S--S--P--A--V--H--L--R--C--T--M--D--P--V-
GAAAGAAGCTCCCAAGTCATCATTACTCAGAAAGCAGACCCAGCCCCCTAAGAAGCAGAGTTCTCCTGCAGTCCATCTTCGGTGCACCATGGACCCTGTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-M--M--T--V--S--P--P--P--A--H--R--H--R--R--R--G--S--P--T--R--C--A--H--C--P--V--A--W--A--P--D--T--D--
ATGATGACTGTGTCCCCGCCCCCAGCTCACCGCCATCGCCGTCGAGGCTCTCCCACACGCTGTGCTCACTGCCCAGTAGCTTGGGCTCCTGACACTGATG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
D--E--K--P--H--Q--Y--P--A--I--C--S--Y--H--W--D--V--P--E--D--W--E--G--F--Q--H--T--Q--G--T--W--V--P--W
ACGAGAAGCCTCATCAGTACCCAGCCATCTGCTCCTACCACTGGGATGTCCCTGAGGACTGGGAAGGCTTCCAACACACTCAGGGGACCTGGGTTCCCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--S--Q--D--A--P--E--S--P--P--Q--T--I--R--F--Q--P--T--V--E--E--R--P--L--K--T--G--I--W--S--E--L--G--L-
GTCTCAGGATGCCCCAGAGTCCCCTCCCCAGACCATCCGCTTCCAGCCTACCGTAGAGGAAAGGCCCCTCAAAACAGGCATATGGTCCGAGCTGGGCCTA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-R--A--Y--V--Y--P--V--N--P--P--P--P--S--P--E--A--P--S--H--K--N--G--G--E--G--A--V--P--E--A--E--A--A--
AGGGCCTATGTGTATCCTGTGAACCCCCCACCTCCCAGCCCTGAGGCTCCTAGCCACAAGAACGGTGGGGAGGGGGCGGTGCCAGAGGCAGAGGCGGCTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
Q--Y--Q--P--V--P--A--P--T--L--G--P--A--V--I--P--E--F--S--R--H--R--S--S--G--R--I--V--Y--D--A--R--D--M
AGTACCAGCCTGTCCCAGCTCCCACCCTGGGCCCAGCAGTCATCCCTGAATTTTCCCGGCACCGCTCCTCAGGCCGAATAGTGTATGATGCCCGGGACAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--R--R--R--L--R--E--L--T--R--E--V--E--A--L--S--G--C--Y--P--L--A--S--G--S--S--T--A--E--E--T--S--K--N-
GAGACGGCGGCTTCGGGAACTGACCCGGGAGGTGGAGGCCCTGTCCGGCTGCTACCCCCTAGCCTCTGGATCCAGCACTGCCGAGGAGACAAGCAAGAAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------->
-W--V--Y--R--S--L--T--G--R--*-
TGGGTGTACCGTTCCCTAACTGGGAGGTGA
                              
------------------------------
------------------------------

Pig Consensus Sequence

>BGISUST0000896414
ATGGCCATGGCTGAGCGGCCCCGGCCCGGGTGGGCCTCATATCACAGCCCCAACACCAACAGCTGCCAGGACCTGGGCAGCTCCATCCTGCTGCTGCTGG
GCCTCATCATCTGCATTAACATTGGCATCAATATGGTGACGCTG--------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
------------------------------


>BGISUSP0000896414
MAMAERPRPGWASYHSPNTNSCQDLGSSILLLLGLIICINIGINMVTL----------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------