Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000175888 (click for geneview)
Transcript ID ENST00000324381(link to ensembl)
Symbol Q8N8T8_HUMAN
Localtion Chromosome:2:56314810:56323631:-1 band: 2p16.1
Description Hypothetical protein FLJ38877.
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--R--L--L--W--S--S--I--A--L--T--F--S--A--S--A--R--R--R--L--R--I--S--S--S--L--L--H--C--S--S--S--S--
ATGAGGTTGCTGTGGTCCAGCATCGCGCTCACCTTCTCCGCCTCGGCGCGCCGCAGGCTGCGGATCAGCTCCTCCTTGCTCCACTGCAGCAGCTCCTCGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
S--D--T--L--D--R--S--S--T--G--A--G--G--A--A--D--E--P--A--G--A--G--E--Q--L--S--A--A--A--A--A--A--A--A
CCGACACTTTGGACAGGTCCTCCACCGGCGCGGGCGGGGCCGCGGACGAGCCGGCCGGGGCTGGGGAACAACTTTCCGCCGCCGCCGCAGCCGCCGCCGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------><-----------------------------------------------------------------------------
--P--P--A--A--F--D--M--V--L--W--Q--K--W--P--G--K--G--L--S--N--H--Q--E--Y--A--K--K--R--G--P--A--S--L-
GCCTCCGGCCGCCTTCGACATGGTACTATGGCAGAAATGGCCAGGGAAGGGTTTATCTAACCACCAGGAGTACGCAAAGAAGAGAGGTCCAGCCAGCCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------><----
-P--L--R--L--L--R--C--Q--V--S--F--G--S--W--K--Q--L--F--C--P--L--P--N--P--R--L--T--A--T--L--Y--G--E--
CCTCTCAGATTGTTAAGATGCCAGGTGTCTTTTGGCTCATGGAAACAGCTGTTCTGCCCCCTCCCGAACCCTAGACTCACAGCTACACTCTATGGGGAAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
R--T--K--G--R--L--L--P--E--E--I--S--I--W--K--S--C--R--S--Q--T--T--H--T--A--I--V--T--P--A--C--L--V--T
GGACAAAGGGAAGGCTGCTTCCTGAAGAGATCTCCATATGGAAGAGCTGCAGATCACAAACAACCCACACAGCCATTGTAACGCCTGCTTGCCTGGTCAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------->
--C--V--S--E--K--P--*-
TTGTGTTTCTGAGAAGCCATAA
                      
----------------------
----------------------