Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000177098 (click for geneview)
Transcript ID ENST00000324727(link to ensembl)
Symbol SCN4B
Localtion Chromosome:11:117509302:117528747:-1 band: 11q23.3
Description Sodium channel beta-4 subunit precursor. [Source:Uniprot/SWISSPROT;Acc:Q8IWT1]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-----------------------------------------------------------><--------------------------------------
-M--P--G--A--G--D--G--G--K--A--P--A--R--W--L--G--T--G--L--L--G--L--F--L--L--P--V--T--L--S--L--E--V--
ATGCCCGGGGCTGGGGACGGAGGCAAAGCCCCGGCGAGATGGCTGGGCACTGGGCTTTTGGGCCTCTTCCTGCTCCCCGTAACCCTGTCGCTGGAGGTGT
                                                               ::::::::::::::.::. ::::::::::::::::::
---------------------------------------------------------------CTCTTCCTGCTCCCTGTGTCCCTGTCGCTGGAGGTGT
----------------------------------------------------------------L--F--L--L--P--V--S--L--S--L--E--V--

----------------------------------------------------------------------------------------------------
S--V--G--K--A--T--D--I--Y--A--V--N--G--T--E--I--L--L--P--C--T--F--S--S--C--F--G--F--E--D--L--H--F--R
CTGTGGGAAAGGCCACCGACATCTACGCTGTCAATGGCACGGAGATCCTGCTGCCCTGCACCTTCTCCAGCTGCTTTGGCTTCGAGGACCTCCACTTCCG
:::::::.:::::::::. ::::::.::.:::::::::::::::::::::::::::::::::::::::::::::::::::::::::.:::: :.::::.:
CTGTGGGGAAGGCCACCACCATCTATGCCGTCAATGGCACGGAGATCCTGCTGCCCTGCACCTTCTCCAGCTGCTTTGGCTTCGAGAACCTACGCTTCTG
S--V--G--K--A--T--T--I--Y--A--V--N--G--T--E--I--L--L--P--C--T--F--S--S--C--F--G--F--E--N--L--R--F--W

---------------------------------><-----------------------------------------------------------------
--W--T--Y--N--S--S--D--A--F--K--I--L--I--E--G--T--V--K--N--E--K--S--D--P--K--V--T--L--K--D--D--D--R-
GTGGACCTACAACAGCAGTGACGCATTCAAGATTCTCATAGAGGGGACTGTGAAGAATGAGAAGTCTGACCCCAAGGTGACGTTGAAAGACGATGACCGC
:::: :::::::::::: .::..:::::::::::                                                                  
GTGGTCCTACAACAGCACCGATACATTCAAGATT------------------------------------------------------------------
--W--S--Y--N--S--T--D--T--F--K--I-------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-I--T--L--V--G--S--T--K--E--K--M--N--N--I--S--I--V--L--R--D--L--E--F--S--D--T--G--K--Y--T--C--H--V--
ATCACTCTGGTAGGCTCTACTAAGGAGAAGATGAACAACATTTCCATTGTGCTGAGGGACCTGGAGTTCAGCGACACGGGCAAATACACCTGCCATGTGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------><------------------------------------
K--N--P--K--E--N--N--L--Q--H--H--A--T--I--F--L--Q--V--V--D--R--L--E--E--V--D--N--T--V--T--L--I--I--L
AGAACCCCAAGGAGAATAATCTCCAGCACCACGCCACCATCTTCCTCCAAGTCGTTGATAGACTGGAAGAAGTGGACAACACAGTGACACTCATCATCCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------------------------><------
--A--V--V--G--G--V--I--G--L--L--I--L--I--L--L--I--K--K--L--I--I--F--I--L--K--K--T--R--E--K--K--K--E-
GGCTGTCGTGGGCGGGGTCATCGGGCTCCTCATCCTCATCCTGCTGATCAAGAAACTCATCATCTTCATCCTGAAGAAGACTCGGGAGAAGAAGAAGGAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------------------------------->
-C--L--V--S--S--S--G--N--D--N--T--E--N--G--L--P--G--S--K--A--E--E--K--P--P--S--K--V--*-
TGTCTCGTGAGCTCCTCGGGGAATGACAACACGGAGAACGGCTTGCCTGGCTCCAAGGCAGAGGAGAAACCACCTTCAAAAGTGTGA
                                                                                       
---------------------------------------------------------------------------------------
---------------------------------------------------------------------------------------

Pig Consensus Sequence

>BGISUST0000889757
---------------------------------------------------------------CTCTTCCTGCTCCCTGTGTCCCTGTCGCTGGAGGTGT
CTGTGGGGAAGGCCACCACCATCTATGCCGTCAATGGCACGGAGATCCTGCTGCCCTGCACCTTCTCCAGCTGCTTTGGCTTCGAGAACCTACGCTTCTG
GTGGTCCTACAACAGCACCGATACATTCAAGATT------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
---------------------------------------------------------------------------------------


>BGISUSP0000889757
---------------------LFLLPVSLSLEVSVGKATTIYAVNGTEILLPCTFSSCFGFENLRFWWSYNSTDTFKI----------------------
----------------------------------------------------------------------------------------------------
-----------------------------