Sequences
EST Library Info
cki1Kidney - RNA from China
cst1Stomach - RNA from China
cte1Testicle - RNA from China
hyp2Hypothalamus
med1Mediastinum
Clusters
Oligos
SNPs

Gene ID ENSG00000106012 (click for geneview)
Transcript ID ENST00000325997(link to ensembl)
Symbol IQCE
Localtion Chromosome:7:2371873:2423779:1 band: 7p22.3
Description IQ motif containing E [Source:RefSeq_peptide;Acc:NP_689771]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<----------------------------------><----------------------------------------------><---------------
-M--F--L--G--T--G--E--P--A--L--D--T--G--D--D--S--L--S--A--V--T--F--D--S--D--V--E--T--K--A--K--R--K--
ATGTTCCTGGGCACCGGGGAGCCGGCCTTGGACACGGGAGATGACAGTCTGTCTGCAGTCACCTTTGACTCTGATGTGGAGACGAAAGCAAAAAGGAAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------><---------------------------------------------------------------------
A--F--H--K--P--P--P--T--S--P--K--S--P--Y--L--S--K--P--R--K--V--A--S--W--R--S--L--R--T--A--G--S--M--P
CTTTCCACAAACCTCCACCCACATCGCCAAAGTCACCTTATCTCTCTAAGCCGAGAAAAGTGGCCTCCTGGAGGTCCCTCAGGACGGCAGGGAGCATGCC
                                :: ::::::: ::::::::::::::::::::::::::::::. :.:: :::::: :::  ::::::::
--------------------------------TCCCCTTATCACTCTAAGCCGAGAAAAGTGGCCTCCTGGAGAGCTCTGAGGACGCCAGCCAGCATGCC
---------------------------------S--P--Y--H--S--K--P--R--K--V--A--S--W--R--A--L--R--T--P--A--S--M--P

--------------------------------------------------------------><------------------------------------
--L--G--G--R--A--S--L--T--P--Q--K--L--W--L--G--T--A--K--P--G--I--L--T--Q--A--L--N--S--P--L--T--W--E-
TCTGGGCGGCCGAGCGTCCCTGACCCCGCAGAAGCTGTGGCTGGGAACCGCAAAGCCAGGTATTCTGACCCAGGCCCTGAACTCACCCCTCACCTGGGAG
::: :: .:: :...::::.:::: :: ::::::::::::::::::: : :::::: ::::                                       
TCTTGGGAGCAGGATGTCCTTGACGCCCCAGAAGCTGTGGCTGGGAAGCTCAAAGCAAGGT---------------------------------------
--L--G--S--R--M--S--L--T--P--Q--K--L--W--L--G--S--S--K--Q--G----------------------------------------

---------------------------------------------------------------------------------------------><-----
-H--A--W--T--G--V--P--G--G--T--P--D--C--L--T--D--T--F--R--V--K--R--P--H--L--R--R--S--A--S--N--G--H--
CATGCGTGGACTGGCGTCCCCGGCGGCACTCCTGACTGTCTGACAGACACCTTCAGAGTGAAGAGGCCACATCTCAGGCGCTCTGCCAGCAACGGTCATG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------><----------------------------------
V--P--G--T--P--V--Y--R--E--K--E--D--M--Y--D--E--I--I--E--L--K--K--S--L--H--V--Q--K--S--D--V--D--L--M
TCCCTGGGACTCCTGTCTACAGAGAAAAAGAAGATATGTATGACGAGATTATTGAGTTAAAGAAGTCATTGCACGTGCAGAAGAGCGACGTGGACCTGAT
                                                                 :::::.:::..:::.::.::.::.:::::.:::::
-----------------------------------------------------------------TCATTACACACGCAAAAAAGTGATGTGGATCTGAT
------------------------------------------------------------------S--L--H--T--Q--K--S--D--V--D--L--M

------------------------------------------------------------------------------><--------------------
--R--T--K--L--R--R--L--E--E--E--N--S--R--K--D--R--Q--I--E--Q--L--L--D--P--S--R--G--T--D--F--V--R--T-
GAGAACGAAGCTCCGGCGCCTGGAGGAGGAAAACAGCAGGAAGGACCGGCAGATAGAGCAGCTCCTGGATCCCAGCCGCGGCACGGATTTTGTTCGGACT
:::.::.:::::.::::::.:.::.:::::.::::::::.:::::::::::::::::::::::..::::          ::: :::: ::::::::::::
GAGGACAAAGCTTCGGCGCTTAGAAGAGGAGAACAGCAGAAAGGACCGGCAGATAGAGCAGCTTTTGGAG---------GGCCCGGAATTTGTTCGGACT
--R--T--K--L--R--R--L--E--E--E--N--S--R--K--D--R--Q--I--E--Q--L--L--E-----------G--P--E--F--V--R--T-

-----------------------------><---------------------------------------------------------------------
-L--A--E--K--R--P--D--A--S--W--V--I--N--G--L--K--Q--R--I--L--K--L--E--Q--Q--C--K--E--K--D--G--T--I--
CTGGCAGAGAAAAGGCCCGATGCCAGTTGGGTCATTAACGGGCTGAAGCAGAGGATCCTGAAGCTGGAACAGCAGTGCAAGGAGAAGGACGGCACCATCA
:::::::::::::::::.:::::..:.::::: :::::::::::.:::::::::::.:: ::::::::.:::::::::::::::::::::..::: ::: 
CTGGCAGAGAAAAGGCCTGATGCTGGCTGGGTGATTAACGGGCTAAAGCAGAGGATTCTCAAGCTGGAGCAGCAGTGCAAGGAGAAGGACAACACGATC-
-L--A--E--K--R--P--D--A--G--W--V--I--N--G--L--K--Q--R--I--L--K--L--E--Q--Q--C--K--E--K--D--N--T--I--

><-----------------------------------------------------------------------><-------------------------
S--K--L--Q--T--D--M--K--T--T--N--L--E--E--M--R--I--A--M--E--T--Y--Y--E--E--V--H--R--L--Q--T--L--L--A
GCAAACTCCAGACCGATATGAAGACTACCAACCTGGAAGAGATGCGGATCGCCATGGAGACATACTACGAGGAGGTGCATCGTCTCCAGACCCTCTTGGC
  ::.:: ::::: ::.::::::::.::.:::.::::.::::::::::::::::::::::: ::::::::::::                          
--AAGCTGCAGACGGACATGAAGACCACTAACTTGGAGGAGATGCGGATCGCCATGGAGACCTACTACGAGGAG--------------------------
---K--L--Q--T--D--M--K--T--T--N--L--E--E--M--R--I--A--M--E--T--Y--Y--E--E---------------------------

-----------------------><---------------------------------------------------------------------------
--S--S--E--T--T--G--K--K--P--L--G--E--K--K--T--G--A--K--R--Q--K--K--M--G--S--A--L--L--S--L--S--R--S-
AAGTTCTGAAACCACCGGAAAGAAGCCCCTGGGGGAGAAGAAGACGGGCGCCAAAAGGCAGAAGAAGATGGGCAGTGCCCTCCTGAGCTTGTCCCGGAGT
                         ::::..: :::::::::.:. ::: ..:::::::::::.::.:::.:::::::::::::::::::::::::::::
-------------------------CCCCCAGTGGAGAAGAAAATCGGCCTTAAAAGGCAGAAAAAAATGAGCAGTGCCCTCCTGAGCTTGTCCCGGAGT
--------------------------P--P--V--E--K--K--I--G--L--K--R--Q--K--K--M--S--S--A--L--L--S--L--S--R--S-

---------------------------------------------------------------------------------------><-----------
-V--Q--E--L--T--E--E--N--Q--S--L--K--E--D--L--D--R--V--L--S--T--S--P--T--I--S--K--T--Q--G--Y--V--E--
GTCCAGGAGCTCACGGAAGAGAACCAGAGCCTGAAGGAGGACCTGGACCGCGTGCTGAGCACCTCCCCAACCATCTCCAAGACACAGGGTTATGTGGAGT
:::::::::::::::::.:::::::::::::: :::::::::::::::::::::::::::: :::::: ::: :::::::::.: ::             
GTCCAGGAGCTCACGGAGGAGAACCAGAGCCTCAAGGAGGACCTGGACCGCGTGCTGAGCAACTCCCCCACCTTCTCCAAGATAAAG-------------
-V--Q--E--L--T--E--E--N--Q--S--L--K--E--D--L--D--R--V--L--S--N--S--P--T--F--S--K--I--K--------------

-------------------------------------------><-------------------------------------------------------
W--S--K--P--R--L--L--R--R--I--V--E--L--E--K--K--L--S--V--M--E--S--S--K--S--H--A--A--E--P--V--R--S--H
GGAGCAAGCCCCGGCTGCTGAGGCGCATTGTGGAGCTGGAGAAGAAACTAAGTGTGATGGAGAGCTCAAAATCACACGCCGCAGAGCCAGTCAGATCACA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--P--P--A--C--L--A--S--S--S--A--L--H--R--Q--P--R--G--D--R--N--K--D--H--E--R--L--R--G--A--V--R--D--L-
CCCGCCAGCCTGCCTTGCATCCAGCTCTGCGCTGCACAGACAGCCACGAGGGGACCGCAACAAGGACCACGAGCGTCTCCGAGGGGCTGTGAGAGACCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------><-------------------------------------------------------
-K--E--E--R--T--A--L--Q--E--Q--L--L--Q--R--D--L--E--V--K--Q--L--L--Q--A--K--A--D--L--E--K--E--L--E--
AAGGAAGAGCGGACCGCGCTGCAGGAGCAGCTGCTGCAGAGAGATTTGGAGGTGAAGCAGCTCCTGCAGGCGAAGGCCGACCTGGAGAAGGAGCTGGAGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------><--------------------------------------------------
C--A--R--E--G--E--E--E--R--R--E--R--E--E--V--L--R--E--E--I--Q--T--L--T--S--K--L--Q--E--L--Q--E--M--K
GCGCGAGGGAGGGCGAGGAGGAGAGGAGAGAGCGAGAGGAGGTTTTGAGAGAGGAGATTCAGACACTTACCAGCAAGCTCCAAGAATTGCAAGAAATGAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------><-----------------------------------------------------------
--K--E--E--K--E--D--C--P--E--V--P--H--K--A--Q--E--L--P--A--P--T--P--S--S--R--H--C--E--Q--D--W--P--P-
GAAAGAAGAGAAAGAGGATTGCCCGGAAGTTCCTCATAAGGCCCAAGAGCTCCCAGCTCCCACTCCCAGCAGCAGGCACTGCGAGCAAGACTGGCCGCCG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-D--S--S--E--E--G--L--P--R--P--R--S--P--C--S--D--G--R--R--D--A--A--A--R--V--L--Q--A--Q--W--K--V--Y--
GATTCCAGCGAGGAGGGGCTCCCGCGGCCCCGCTCCCCCTGCTCTGATGGGAGAAGAGACGCCGCGGCCAGAGTCCTGCAGGCCCAGTGGAAGGTGTACA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------><----------------------><-------------------------------------------------------------------
K--H--K--K--K--K--A--V--L--D--E--A--A--V--V--L--Q--A--A--F--R--G--H--L--T--R--T--K--L--L--A--S--K--A
AGCACAAGAAAAAAAAGGCTGTTCTGGATGAGGCGGCTGTGGTGCTTCAGGCAGCTTTCAGGGGACATCTCACGCGGACAAAGCTCTTAGCAAGCAAAGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------><--------------------------------------------------------
--H--G--S--E--P--P--S--V--P--G--L--P--D--Q--S--S--P--V--P--R--V--P--S--P--I--A--Q--A--T--G--S--P--V-
ACATGGCTCAGAGCCACCCAGCGTGCCAGGCCTCCCAGACCAGAGCTCTCCTGTGCCCCGCGTTCCGAGCCCCATCGCCCAGGCCACGGGCAGCCCTGTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------><----------------------------------
-Q--E--E--A--I--V--I--I--Q--S--A--L--R--A--H--L--A--R--A--R--H--S--A--T--G--K--R--T--T--T--A--A--S--
CAGGAGGAGGCCATCGTCATCATCCAGTCCGCTCTGCGGGCACACCTGGCCCGGGCCAGGCACAGTGCTACCGGTAAAAGAACCACCACCGCAGCTTCTA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------><------------------------------
T--R--R--R--S--A--S--A--T--H--G--D--A--S--S--P--P--F--L--A--A--L--P--D--P--S--P--S--G--P--Q--A--L--A
CCAGGAGGAGATCGGCTTCAGCCACACACGGGGACGCCTCCTCCCCACCCTTCCTCGCAGCTCTTCCTGACCCCTCTCCCTCAGGGCCACAGGCCTTGGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------------------->
--P--L--P--G--D--D--V--N--S--D--D--S--D--D--I--V--I--A--P--S--L--P--T--K--N--F--P--V--*-
ACCTCTACCTGGGGATGACGTCAACTCCGATGATTCCGACGATATTGTCATTGCACCGTCTCTGCCCACGAAGAACTTTCCAGTTTAG
                                                                                        
----------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------

Pig Consensus Sequence

>BGISUST0000894415
----------------------------------------------------------------------------------------------------
--------------------------------TCCCCTTATCACTCTAAGCCGAGAAAAGTGGCCTCCTGGAGAGCTCTGAGGACGCCAGCCAGCATGCC
TCTTGGGAGCAGGATGTCCTTGACGCCCCAGAAGCTGTGGCTGGGAAGCTCAAAGCAAGGT---------------------------------------
----------------------------------------------------------------------------------------------------
-----------------------------------------------------------------TCATTACACACGCAAAAAAGTGATGTGGATCTGAT
GAGGACAAAGCTTCGGCGCTTAGAAGAGGAGAACAGCAGAAAGGACCGGCAGATAGAGCAGCTTTTGGAG---------GGCCCGGAATTTGTTCGGACT
CTGGCAGAGAAAAGGCCTGATGCTGGCTGGGTGATTAACGGGCTAAAGCAGAGGATTCTCAAGCTGGAGCAGCAGTGCAAGGAGAAGGACAACACGATC-
--AAGCTGCAGACGGACATGAAGACCACTAACTTGGAGGAGATGCGGATCGCCATGGAGACCTACTACGAGGAG--------------------------
-------------------------CCCCCAGTGGAGAAGAAAATCGGCCTTAAAAGGCAGAAAAAAATGAGCAGTGCCCTCCTGAGCTTGTCCCGGAGT
GTCCAGGAGCTCACGGAGGAGAACCAGAGCCTCAAGGAGGACCTGGACCGCGTGCTGAGCAACTCCCCCACCTTCTCCAAGATAAAG-------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------


>BGISUSP0000894415
--------------------------------------------SPYHSKPRKVASWRALRTPASMPLGSRMSLTPQKLWLGSSKQG-------------
-------------------------------------------------------SLHTQKSDVDLMRTKLRRLEEENSRKDRQIEQLLE---GPEFVRT
LAEKRPDAGWVINGLKQRILKLEQQCKEKDNTI-KLQTDMKTTNLEEMRIAMETYYEE-----------------PPVEKKIGLKRQKKMSSALLSLSRS
VQELTEENQSLKEDLDRVLSNSPTFSKIK-----------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
------------------------------------------------------------------------------------------------