Sequences
EST Library Info
cbl2Blood
che1Heart - RNA from China
ret1Retina
spl1Spleen
tes1Testes
ute1Uterus
Clusters
Oligos
SNPs

Gene ID ENSG00000177917 (click for geneview)
Transcript ID ENST00000326446(link to ensembl)
Symbol ARL6IP6
Localtion Chromosome:2:153399936:153443199:1 band: 2q23.3
Description ADP-ribosylation-like factor 6 interacting protein 6 [Source:RefSeq_peptide;Acc:NP_689735]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--S--F--A--E--S--G--W--R--S--A--L--R--R--R--G--P--G--T--P--G--P--V--A--R--P--S--Y--S--S--F--T--Q--
ATGTCGTTTGCTGAGAGCGGGTGGCGGTCGGCTCTGCGGCGCCGCGGTCCCGGCACCCCGGGCCCTGTGGCTCGGCCATCGTATTCCTCCTTTACTCAGG
                                                :: ::.::::: : :::  : ::::::::. :.: :::: :.:..:: ::::
------------------------------------------------CCGGGTACCCCTGTCCCGTTCGCTCGGCCGGCATTTTCCGCTTCCACGCAGG
-------------------------------------------------P--G--T--P--V--P--F--A--R--P--A--F--S--A--S--T--Q--

----------------------------------------------------------------------------------------------------
G--D--S--W--G--E--G--E--V--D--E--E--E--G--C--D--Q--V--A--R--D--L--R--A--E--F--S--A--G--A--W--S--E--P
GGGACAGCTGGGGTGAAGGCGAAGTCGACGAGGAGGAGGGATGCGACCAAGTGGCCCGCGACCTGCGGGCGGAGTTCTCGGCTGGGGCGTGGTCAGAGCC
:.::::::::::::::.::.::::::::.:::::::::::::::::::.:::.:::::.::::::::.:::::.::::::                    
GAGACAGCTGGGGTGAGGGTGAAGTCGATGAGGAGGAGGGATGCGACCGAGTAGCCCGTGACCTGCGAGCGGAATTCTCG--------------------
G--D--S--W--G--E--G--E--V--D--E--E--E--G--C--D--R--V--A--R--D--L--R--A--E--F--S---------------------

----------------------------------------------------------------------------------------------------
--R--K--R--S--V--L--P--P--D--G--N--G--S--P--V--L--P--D--K--R--N--G--I--F--P--A--A--A--G--S--R--A--Q-
CAGAAAGCGCTCGGTGCTCCCGCCGGACGGGAACGGGTCGCCCGTTCTGCCCGATAAGCGCAATGGTATCTTTCCCGCGGCCGCGGGCAGCAGAGCCCAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------------------------------->
-P--R--R--W--P--V--Q--V--L--S--I--L--C--S--L--L--F--A--I--L--L--A--F--L--L--A--I--A--Y--L--I--V--K--
CCTCGGCGGTGGCCGGTCCAGGTCCTCTCTATTCTCTGCTCGCTGCTCTTCGCCATTCTTCTCGCCTTCCTCCTCGCCATCGCCTACTTGATCGTTAAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

<----------------------------------------------------><---------------------------------------------
E--L--H--A--E--N--L--K--N--E--D--D--V--D--T--G--L--L--G--F--W--T--L--L--I--I--S--L--T--A--G--F--S--C
AGTTGCATGCTGAGAATTTGAAAAATGAAGATGATGTAGACACTGGACTATTAGGATTCTGGACTCTACTTATAATATCCCTAACTGCTGGATTCTCCTG
  ::.:::::::::::::::::.::::::::::::::  :.:::::.::.:::   ::::::::::::::::::::::::::::: ::::::::::::::
--TTACATGCTGAGAATTTGAAGAATGAAGATGATGTTCATACTGGGCTGTTA---TTCTGGACTCTACTTATAATATCCCTAACAGCTGGATTCTCCTG
---L--H--A--E--N--L--K--N--E--D--D--V--H--T--G--L--L-----F--W--T--L--L--I--I--S--L--T--A--G--F--S--C

--------------------------------------------------------------------------------------><------------
--C--S--F--S--W--T--V--T--Y--F--D--S--F--E--P--G--M--F--P--P--T--P--L--S--P--A--R--F--K--K--L--T--G-
TTGCAGCTTTTCTTGGACAGTGACTTACTTTGATTCTTTTGAACCAGGAATGTTTCCTCCTACTCCTCTTTCACCTGCCAGGTTCAAGAAACTGACTGGA
.::::::::::::::::::::::::::.::::::::::::::::::::::::::::::::::::::.::::::::::::::::::   ::::::::::::
CTGCAGCTTTTCTTGGACAGTGACTTATTTTGATTCTTTTGAACCAGGAATGTTTCCTCCTACTCCCCTTTCACCTGCCAGGTTC---AAACTGACTGGA
--C--S--F--S--W--T--V--T--Y--F--D--S--F--E--P--G--M--F--P--P--T--P--L--S--P--A--R--F-----K--L--T--G-

-------------------------------------------------------------------------------->
-H--S--F--H--M--G--Y--S--M--A--I--L--N--G--I--V--A--A--L--T--V--A--W--C--L--M--*-
CATTCTTTCCACATGGGCTATAGCATGGCGATTTTGAATGGCATCGTAGCTGCTCTTACTGTAGCATGGTGCCTCATGTAA
::::::::::::::::::::.::::::::.:::.:::::::..:.:::::::::::.:::::.:::::::::::.::::::
CATTCTTTCCACATGGGCTACAGCATGGCAATTCTGAATGGTGTTGTAGCTGCTCTCACTGTGGCATGGTGCCTTATGTAA
-H--S--F--H--M--G--Y--S--M--A--I--L--N--G--V--V--A--A--L--T--V--A--W--C--L--M--*-

Pig Consensus Sequence

>BGISUST0000888476
------------------------------------------------CCGGGTACCCCTGTCCCGTTCGCTCGGCCGGCATTTTCCGCTTCCACGCAGG
GAGACAGCTGGGGTGAGGGTGAAGTCGATGAGGAGGAGGGATGCGACCGAGTAGCCCGTGACCTGCGAGCGGAATTCTCG--------------------
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------
--TTACATGCTGAGAATTTGAAGAATGAAGATGATGTTCATACTGGGCTGTTA---TTCTGGACTCTACTTATAATATCCCTAACAGCTGGATTCTCCTG
CTGCAGCTTTTCTTGGACAGTGACTTATTTTGATTCTTTTGAACCAGGAATGTTTCCTCCTACTCCCCTTTCACCTGCCAGGTTC---AAACTGACTGGA
CATTCTTTCCACATGGGCTACAGCATGGCAATTCTGAATGGTGTTGTAGCTGCTCTCACTGTGGCATGGTGCCTTATGTAA


>BGISUSP0000888476
----------------PGTPVPFARPAFSASTQGDSWGEGEVDEEEGCDRVARDLRAEFS----------------------------------------
----------------------------------LHAENLKNEDDVHTGLL-FWTLLIISLTAGFSCCSFSWTVTYFDSFEPGMFPPTPLSPARF-KLTG
HSFHMGYSMAILNGVVAALTVAWCLM*