Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000183952 (click for geneview)
Transcript ID ENST00000327725(link to ensembl)
Symbol Q9H5Q9_HUMAN
Localtion Chromosome:5:180614754:180616921:1 band: 5q35.3
Description hypothetical protein FLJ23053
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--Y--F--K--L--Q--C--V--K--T--L--L--K--I--L--T--F--E--M--F--K--Y--R--L--F--F--I--V--L--P--T--L--G--
ATGTATTTTAAGCTTCAGTGTGTTAAAACTCTGTTGAAAATTTTAACTTTTGAAATGTTCAAGTATAGATTATTTTTCATTGTTCTTCCAACCTTGGGGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
L--F--C--P--Q--V--Q--Q--N--P--F--F--F--G--N--Q--E--T--S--I--C--N--R--K--H--G--M--A--F--R--S--S--K--S
TGTTCTGTCCACAAGTTCAGCAGAATCCGTTTTTCTTTGGCAACCAAGAAACTTCAATATGTAACAGAAAACATGGAATGGCATTTAGATCTTCAAAAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--R--A--N--W--N--G--M--Y--C--F--S--Q--W--S--M--L--T--A--R--L--K--I--S--S--R--L--W--V--I--S--E--S--S-
CAGGGCAAACTGGAATGGAATGTACTGTTTCTCACAGTGGTCTATGCTGACAGCAAGGCTGAAGATTTCCAGTAGGTTATGGGTAATCAGTGAAAGTTCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-C--L--V--V--T--A--A--V--H--L--E--Y--Q--F--S--S--I--F--A--K--N--P--N--L--T--Q--F--A--V--V--P--L--R--
TGCTTGGTGGTGACAGCTGCAGTACATCTTGAATACCAGTTTTCTTCAATCTTTGCCAAAAACCCAAATTTAACACAGTTTGCTGTAGTGCCATTAAGAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------->
Y--T--P--I--Q--F--P--P--T--R--F--I--*-
ATACTCCTATACAATTTCCTCCAACTCGGTTCATTTGA
                                      
--------------------------------------
--------------------------------------