Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000183279 (click for geneview)
Transcript ID ENST00000328081(link to ensembl)
Localtion Chromosome:5:179617565:179619581:1 band: 5q35.3
Description  
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-G--V--K--P--Y--K--C--K--Q--C--E--K--T--F--I--S--L--T--N--V--Q--R--H--M--V--T--H--T--G--N--R--P--H--
GGGGTGAAGCCATACAAATGTAAACAATGTGAGAAAACCTTCATTTCTCTCACAAATGTCCAAAGACACATGGTAACACACACTGGTAACAGGCCTCATA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
K--C--K--K--C--G--K--T--F--K--F--L--Y--L--L--Q--R--H--K--V--I--Y--N--G--E--K--P--C--E--W--K--K--G--G
AATGTAAGAAATGTGGGAAGACATTTAAGTTTCTCTATTTACTTCAAAGACACAAAGTAATTTACAACGGAGAAAAACCCTGTGAATGGAAGAAAGGTGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--K--A--L--R--F--C--S--Y--F--Q--K--H--K--R--T--H--S--G--E--K--P--Y--K--C--Q--K--C--E--K--A--F--G--H-
TAAAGCCTTGAGATTTTGCAGTTATTTTCAAAAACATAAAAGAACTCACAGTGGGGAAAAACCTTATAAATGTCAGAAATGTGAGAAAGCCTTTGGACAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-S--G--Y--L--H--N--H--K--G--A--H--A--E--E--K--P--R--E--C--R--K--C--G--K--R--F--S--F--C--S--Y--F--Q--
TCTGGTTACCTTCATAACCATAAAGGTGCTCATGCTGAAGAGAAACCCCGTGAATGTAGGAAATGTGGGAAACGATTCAGTTTTTGTAGTTACTTTCAAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------><-------------------------------------------------------------------------------------
R--H--K--E--L--C--E--K--S--S--M--C--L--R--N--M--V--K--D--S--L--F--P--V--P--F--R--N--I--K--E--I--I--L
GACATAAAGAGCTCTGTGAAAAATCTTCCATGTGTTTAAGAAATATGGTAAAAGACTCACTCTTTCCAGTTCCATTCAGAAACATAAAAGAAATAATACT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--E--R--N--P--I--N--V--R--N--V--A--K--P--S--V--I--P--A--P--C--E--D--I--K--E--H--I--L--E--R--N--P--I-
GGAGAGAAACCCTATAAATGTAAGAAATGTAGCAAAGCCTTCAGTCATCCCCGCTCCATGTGAAGACATCAAAGAACACATATTGGAGAGAAATCCTATA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-T--V--K--N--V--A--K--P--S--V--N--T--V--P--L--E--D--M--K--E--L--I--L--E--R--N--P--M--N--V--K--N--G--
ACTGTAAAAAATGTGGCAAAGCCTTCAGTCAACACAGTTCCCTTAGAAGACATGAAAGAACTCATACTGGAGAGAAACCCAATGAATGTCAAAAATGGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------><------------------------------------------------------------------------------------
I--K--A--S--V--D--I--P--V--L--Y--V--N--M--K--E--L--T--L--E--R--N--P--L--T--V--R--N--V--V--K--S--S--D
TAAAGGCTTCAGTCGACATTCCAGTTCTCTATGTAAACATGAAAGAACTCACACTGGAGAGGAACCCTTTGACTGTAAGGAATGTGGTCAAGTCTTCAGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--I--P--V--L--Y--V--N--M--K--E--L--T--L--E--R--N--P--L--T--V--R--D--V--V--K--S--S--D--I--P--I--L--Y-
CATTCCAGTTCTCTACGTAAACATGAAAGAACTCACACTGGAGAGAAACCCTTTGACCGTAAGGGATGTGGTCAAGTCTTCAGACATTCCAATTCTCTAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-V--N--M--K--N--L--T--L--E--R--N--P--L--T--V--R--N--V--V--K--S--S--D--I--P--V--L--Y--V--N--T--E--E--
GTAAACATGAAAAATCTCACACTGGAGAGAAACCCTTTGACTGTAAGGAATGTGGTCAAGTCTTCAGACATTCCAGTTCTCTATGTAAACACGGAAGAAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
L--T--L--E--R--N--P--L--T--V--R--D--V--V--K--S--S--D--I--P--V--L--Y--V--N--M--K--N--F--T--L--E--R--N
TCACACTGGAGAGAAACCCTTTGACTGTAAGGGATGTGGTCAAGTCTTCAGACATTCCAGTTCTCTATGTAAACATGAAAAATTTCACACTGGAGAGAAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------><-----------------------------------------------------------------------------------------
--P--L--T--T--C--N--V--V--K--S--S--D--I--P--V--L--Y--V--N--M--K--E--L--K--L--E--R--N--P--M--T--V--R-
CCCTTTGACTACTTGCAATGTGGTGAAGTCTTCAGATATTCCAGTTCTCTATGTAAACATGAAAGAACTCAAACTGGAGAGAAACCCTATGACTGTAAGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-H--V--A--K--P--L--D--I--P--V--L--Y--V--N--M--K--K--L--I--L--C--R--N--P--E--N--V--R--I--W--G--K--H--
CATGTGGCAAAGCCTTTAGATATTCCAGTCCTGTATGTAAACATGAAAAAACTCATACTCTGTAGAAATCCTGAGAATGTAAGGATTTGGGGAAAACATT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------->
S--V--N--S--V--I--F--E--N--M--K--E--I--I--L--E-
CAGTTAATTCAGTTATCTTTGAAAACATGAAAGAAATTATACTGGAG
                                               
-----------------------------------------------
-----------------------------------------------