Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000127318 (click for geneview)
Transcript ID ENST00000328087(link to ensembl)
Symbol IL22
Localtion Chromosome:12:66928292:66933651:-1 band: 12q15
Description Interleukin-22 precursor (IL-22) (IL-10-related T-cell-derived inducible factor) (IL-TIF). [Source:Uniprot/SWISSPROT;Acc:Q9GZX6]
Phylogenetic trees Goto TreeFam
Found Homolog YES

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--A--A--L--Q--K--S--V--S--S--F--L--M--G--T--L--A--T--S--C--L--L--L--L--A--L--L--V--Q--G--G--A--A--
ATGGCCGCCCTGCAGAAATCTGTGAGCTCTTTCCTTATGGGGACCCTGGCCACCAGCTGCCTCCTTCTCTTGGCCCTCTTGGTACAGGGAGGAGCAGCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------------------------------><-------------
A--P--I--S--S--H--C--R--L--D--K--S--N--F--Q--Q--P--Y--I--T--N--R--T--F--M--L--A--K--E--A--S--L--A--D
CGCCCATCAGCTCCCACTGCAGGCTTGACAAGTCCAACTTCCAGCAGCCCTATATCACCAACCGCACCTTCATGCTGGCTAAGGAGGCTAGCTTGGCTGA
                                                                                      :::::.::::: ::
--------------------------------------------------------------------------------------GCTAGTTTGGCAGA
---------------------------------------------------------------------------------------A--S--L--A--D

---------------------------------------------------><-----------------------------------------------
--N--N--T--D--V--R--L--I--G--E--K--L--F--H--G--V--S--M--S--E--R--C--Y--L--M--K--Q--V--L--N--F--T--L-
TAACAACACAGACGTTCGTCTCATTGGGGAGAAACTGTTCCACGGAGTCAGTATGAGTGAGCGCTGCTATCTGATGAAGCAGGTGCTGAACTTCACCCTT
::::::::::::::::::::::::::::.: :: :::::::: :::::::.:::::: :::::::::::.:::.:::::::::: :::::::::::::::
TAACAACACAGACGTTCGTCTCATTGGGAATAATCTGTTCCAGGGAGTCAATATGAGAGAGCGCTGCTACCTGGTGAAGCAGGTCCTGAACTTCACCCTT
--N--N--T--D--V--R--L--I--G--N--N--L--F--Q--G--V--N--M--R--E--R--C--Y--L--V--K--Q--V--L--N--F--T--L-

-----------------------------------------------------------------------------------------------><---
-E--E--V--L--F--P--Q--S--D--R--F--Q--P--Y--M--Q--E--V--V--P--F--L--A--R--L--S--N--R--L--S--T--C--H--
GAAGAAGTGCTGTTCCCTCAATCTGATAGGTTCCAGCCTTATATGCAGGAGGTGGTGCCCTTCCTGGCCAGGCTCAGCAACAGGCTAAGCACATGTCATA
:::::::::::::::::. : ::::::::.::::: ::.::.:::::::::::::.:.::::::::: ::: :::::::: :.:::::::          
GAAGAAGTGCTGTTCCCCAACTCTGATAGATTCCACCCCTACATGCAGGAGGTGGCGTCCTTCCTGGACAGCCTCAGCAAAAAGCTAAGC----------
-E--E--V--L--F--P--N--S--D--R--F--H--P--Y--M--Q--E--V--A--S--F--L--D--S--L--S--K--K--L--S-----------

-------------------------------------------------------------><-------------------------------------
I--E--G--D--D--L--H--I--Q--R--N--V--Q--K--L--K--D--T--V--K--K--L--G--E--S--G--E--I--K--A--I--G--E--L
TTGAAGGTGATGACCTGCATATCCAGAGGAATGTGCAAAAGCTGAAGGACACAGTGAAAAAGCTTGGAGAGAGTGGAGAGATCAAAGCAATTGGAGAACT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------->
--D--L--L--F--M--S--L--R--N--A--C--I--*-
GGATTTGCTGTTTATGTCTCTGAGAAATGCCTGCATTTGA
                                        
----------------------------------------
----------------------------------------

Pig Consensus Sequence

>BGISUST0000883395
----------------------------------------------------------------------------------------------------
--------------------------------------------------------------------------------------GCTAGTTTGGCAGA
TAACAACACAGACGTTCGTCTCATTGGGAATAATCTGTTCCAGGGAGTCAATATGAGAGAGCGCTGCTACCTGGTGAAGCAGGTCCTGAACTTCACCCTT
GAAGAAGTGCTGTTCCCCAACTCTGATAGATTCCACCCCTACATGCAGGAGGTGGCGTCCTTCCTGGACAGCCTCAGCAAAAAGCTAAGC----------
----------------------------------------------------------------------------------------------------
----------------------------------------


>BGISUSP0000883395
--------------------------------------------------------------ASLADNNTDVRLIGNNLFQGVNMRERCYLVKQVLNFTL
EEVLFPNSDRFHPYMQEVASFLDSLSKKLS--------------------------------------------------