Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000184650 (click for geneview)
Transcript ID ENST00000328248(link to ensembl)
Symbol ODF4
Localtion Chromosome:17:8183913:8190088:1 band: 17p13.1
Description OPPO 1 [Source:RefSeq_peptide;Acc:NP_694552]
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--D--A--E--Y--S--G--N--E--F--P--R--S--E--G--E--R--D--Q--H--Q--R--P--G--K--E--R--K--S--G--E--A--G--
ATGGATGCAGAGTACTCTGGGAATGAGTTCCCCAGGTCAGAAGGAGAAAGAGACCAACATCAGAGACCTGGAAAGGAAAGGAAGAGTGGGGAGGCAGGAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
W--G--T--G--E--L--G--Q--D--G--R--L--L--S--S--T--L--S--L--S--S--N--R--S--L--G--Q--R--Q--N--S--P--L--P
GGGGCACAGGTGAGCTGGGACAAGATGGGAGACTGCTGTCCTCCACCCTCTCCCTCAGTAGTAACAGGTCCTTGGGCCAGCGCCAGAACTCTCCGCTGCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--F--Q--W--R--I--T--H--S--F--R--W--M--A--Q--V--L--A--S--E--L--S--L--V--A--F--I--L--L--L--V--V--A--F-
CTTTCAATGGAGAATCACACACAGCTTCCGCTGGATGGCCCAGGTGTTGGCCTCTGAGCTCAGCCTGGTTGCCTTTATCCTACTATTGGTCGTGGCCTTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-S--K--K--W--L--D--L--S--R--S--L--F--Y--Q--R--W--P--V--D--V--S--N--R--I--H--T--S--A--H--V--M--S--M--
TCCAAGAAATGGCTGGACCTCTCTAGGAGCCTCTTCTACCAGCGCTGGCCCGTGGATGTCAGCAACAGAATCCACACATCAGCCCACGTTATGTCCATGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------------><---------------------------------------------
G--L--L--H--F--Y--K--S--R--S--C--S--D--L--E--N--G--K--V--T--F--I--F--S--T--L--M--L--F--P--I--N--I--W
GGCTCCTGCACTTTTACAAATCCAGGAGCTGTTCTGACTTAGAGAATGGGAAAGTCACCTTCATCTTCTCCACCCTCATGCTATTCCCCATTAACATCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------><----------
--I--F--E--L--E--R--N--V--S--I--P--I--G--W--S--Y--F--I--G--W--L--V--L--I--L--Y--F--T--C--A--I--L--C-
GATCTTCGAGTTGGAAAGGAATGTATCCATCCCCATAGGCTGGAGCTATTTCATTGGTTGGCTGGTGCTTATCCTATACTTCACCTGCGCGATCCTTTGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-Y--F--N--H--K--S--F--W--S--L--I--L--S--H--P--S--G--A--V--S--C--S--S--S--F--G--S--V--E--E--S--P--R--
TACTTCAACCATAAAAGTTTCTGGAGTCTGATTCTGAGCCACCCCAGTGGTGCCGTGTCCTGCAGCAGCAGTTTCGGCTCAGTAGAAGAATCTCCAAGGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------------------->
A--Q--T--I--T--D--T--P--I--T--Q--E--G--V--L--D--P--E--Q--K--D--T--H--V--*-
CACAGACGATCACAGACACCCCCATCACCCAGGAGGGAGTCCTGGATCCTGAGCAGAAGGATACACATGTGTAA
                                                                          
--------------------------------------------------------------------------
--------------------------------------------------------------------------