Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000182711 (click for geneview)
Transcript ID ENST00000329156(link to ensembl)
Localtion Chromosome:5:179053804:179054301:1 band: 5q35.3
Description  
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--A--K--G--D--P--K--K--P--K--G--K--M--S--A--Y--V--F--F--V--Q--T--C--R--E--E--C--K--K--K--N--P--V--
ATGGCTAAAGGTGACCCCAAGAAACCAAAGGGCAAGATGTCTGCTTATGTCTTCTTTGTGCAGACATGCAGAGAAGAATGTAAAAAGAAAAACCCTGTCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
N--F--A--E--F--S--K--K--C--S--E--R--W--K--T--M--S--G--K--E--K--S--K--F--D--E--M--A--K--T--D--K--V--H
ATTTTGCAGAATTTTCCAAGAAGTGCTCTGAAAGGTGGAAGACAATGTCCGGGAAAGAGAAGTCTAAATTTGATGAAATGGCAAAGACGGATAAAGTGCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--C--D--R--E--M--K--G--P--A--K--G--G--K--K--K--K--D--P--S--A--P--K--R--P--P--S--G--F--F--L--F--S--S-
CTGTGATCGGGAAATGAAGGGACCAGCTAAGGGAGGCAAGAAGAAGAAGGATCCTAGTGCCCCCAAAAGGCCACCATCTGGATTCTTCCTGTTCTCTTCG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-E--I--R--P--K--I--K--S--T--N--P--G--I--S--I--G--D--V--A--K--K--L--G--E--M--W--N--N--L--N--D--S--E--
GAAATCCGCCCCAAGATCAAATCCACAAACCCTGGCATCTCTATTGGAGATGTGGCAAAAAAGCTGGGTGAGATGTGGAATAACTTAAATGACAGTGAAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------------------------------------------->
K--Q--P--Y--I--T--K--T--A--K--L--K--E--K--Y--E--K--D--V--A--D--S--K--S--K--G--K--F--D--G--S--K--R-
AGCAGCCTTACATCACTAAGACGGCAAAGCTGAAGGAGAAGTACGAGAAGGATGTTGCTGATTCTAAGTCGAAAGGGAAGTTTGATGGCTCAAAGCGT
                                                                                                  
--------------------------------------------------------------------------------------------------
--------------------------------------------------------------------------------------------------