Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000182794 (click for geneview)
Transcript ID ENST00000329187(link to ensembl)
Symbol Q9H5H6_HUMAN
Localtion Chromosome:16:87523855:87524442:1 band: 16q24.3
Description Hypothetical protein FLJ23429.
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--V--H--V--K--A--T--N--T--Q--S--R--M--V--H--A--K--A--T--N--T--H--S--C--I--I--H--A--K--V--T--N--T--
ATGGTCCACGTAAAAGCTACCAATACCCAGAGCCGCATGGTCCACGCAAAAGCTACCAATACCCACAGCTGCATCATCCACGCAAAAGTCACCAATACCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
H--S--C--I--V--H--A--K--A--T--N--T--H--S--C--M--V--H--V--K--A--T--N--T--Q--S--C--M--V--H--V--K--A--T
ACAGCTGCATCGTCCACGCAAAAGCTACCAATACCCACAGCTGCATGGTCCACGTAAAAGCTACCAATACCCAGAGCTGCATGGTCCACGTAAAAGCTAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--N--T--H--S--C--M--V--H--A--K--A--T--N--T--H--S--C--I--I--H--A--K--V--T--N--T--H--S--C--I--V--H--A-
CAATACCCACAGCTGCATGGTCCACGCAAAAGCTACCAATACCCACAGCTGCATCATCCACGCAAAAGTCACCAATACCCACAGCTGCATCGTCCACGCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-K--A--T--H--A--H--S--C--V--V--H--A--K--A--T--N--T--H--S--C--M--V--H--A--K--A--T--N--T--H--S--C--I--
AAAGCTACCCATGCCCACAGCTGCGTGGTCCACGCAAAAGCTACCAATACCCACAGCTGCATGGTCCACGCAAAAGCTACCAATACCCACAGCTGCATCG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
V--H--A--K--A--T--H--A--H--S--C--I--V--H--A--K--A--T--H--A--H--S--C--M--V--H--H--N--N--N--G--G--N--N
TCCACGCAAAAGCTACCCATGCCCACAGCTGCATCGTCCACGCAAAAGCTACCCATGCCCACAGCTGCATGGTCCACCATAACAACAATGGGGGCAACAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------------------->
--P--R--V--H--Q--R--T--H--K--T--W--S--F--C--T--V--Q--C--S--S--A--T--G--K--E--A--P--H--*-
CCCACGCGTCCATCAACGGACACACAAAACGTGGTCTTTCTGCACAGTGCAGTGCAGCTCAGCCACAGGGAAGGAGGCTCCCCACTAG
                                                                                        
----------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------