Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000185932 (click for geneview)
Transcript ID ENST00000329573(link to ensembl)
Symbol XP_208545.3
Localtion Chromosome:11:120737769:120738782:-1 band: 11q23.3
Description PREDICTED: similar to bone morphogenetic protein receptor, type IA precursor; activin A receptor, type II-like kinase 3
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-D--E--A--F--I--P--V--G--E--S--L--K--D--L--I--D--Q--S--Q--S--S--G--S--G--S--G--L--P--L--L--V--Q--R--
GATGAAGCATTTATTCCAGTTGGAGAATCACTAAAAGACCTTATTGACCAGTCACAAAGTTCTGGTAGTGGGTCTGGACTACCTTTATTGGTTCAGCGAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
T--I--A--K--Q--I--Q--M--V--R--Q--V--G--K--G--R--Y--G--E--V--W--M--G--K--W--R--G--E--K--V--A--V--K--V
CTATTGCCAAACAGATTCAGATGGTCCGGCAAGTTGGTAAAGGCCGATATGGAGAAGTATGGATGGGCAAATGGCGTGGCGAAAAAGTGGCGGTGAAAGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--F--F--T--T--E--E--A--S--W--F--R--E--T--E--I--Y--Q--T--V--L--M--R--H--E--N--I--L--G--F--I--A--A--D-
ATTCTTTACCACTGAAGAAGCCAGCTGGTTTCGAGAAACAGAAATCTACCAAACTGTGCTAATGCGCCATGAAAACATACTTGGTTTCATAGCAGCAGAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-I--K--G--T--G--S--W--T--Q--L--Y--L--I--T--D--Y--H--E--N--G--S--L--Y--D--F--L--K--C--A--T--L--D--T--
ATTAAAGGTACAGGTTCCTGGACTCAGCTCTATTTGATTACTGATTACCATGAAAATGGATCTCTCTATGACTTCCTGAAATGTGCTACACTGGACACCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
R--A--L--L--K--S--A--Y--S--A--A--C--G--L--C--H--L--H--T--E--I--Y--G--T--Q--G--K--P--A--I--A--H--R--D
GAGCCCTGCTTAAATCGGCTTATTCAGCTGCCTGTGGTCTGTGCCACCTGCACACAGAAATTTATGGCACCCAAGGAAAGCCCGCAATTGCTCATCGAGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--L--K--S--K--N--I--L--I--K--K--N--G--S--C--C--I--A--D--L--G--L--A--V--K--F--N--S--D--T--N--E--V--D-
CCTAAAGAGCAAAAACATCCTCATCAAGAAAAATGGGAGTTGCTGCATTGCTGACCTGGGCCTTGCTGTTAAATTCAACAGTGACACAAATGAAGTTGAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-V--P--L--N--T--R--V--G--T--K--R--Y--M--A--P--E--V--L--D--E--S--L--N--K--N--H--F--Q--P--Y--I--M--A--
GTGCCCTTGAATACCAGGGTGGGCACCAAACGCTATATGGCTCCAGAAGTGCTGGACGAAAGCCTGAACAAAAACCACTTCCAGCCCTACATCATGGCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
D--I--Y--S--F--G--L--I--I--W--E--M--A--R--R--C--I--T--G--G--I--V--E--E--Y--Q--L--P--Y--Y--N--M--V--P
ACATCTACAGCTTCGGCCTAATCATTTGGGAGATGGCTCGTCGTTGTATCACAGGAGGGATTGTGGAAGAGTACCAATTGCCATATTACAACATGGTACC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--S--D--P--S--Y--E--D--M--R--E--V--V--C--V--K--R--L--R--P--I--V--S--N--R--W--N--S--D--E--C--L--R--A-
GAGTGATCCGTCATACGAAGATATGCGTGAGGTTGTGTGTGTCAAACGTTTGCGGCCAATTGTGTCTAATCGGTGGAACAGTGATGAATGTCTACGAGCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-V--L--K--L--M--S--E--C--W--A--H--N--P--A--S--R--L--T--A--L--R--I--K--K--M--L--A--K--M--V--E--S--Q--
GTTTTGAAGCTAATGTCAGAATGCTGGGCCCACAATCCAGCCTCCAGACTCACAGCGTTGAGAATTAAGAAGATGCTTGCCAAGATGGTTGAATCCCAAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------->
D--V--K--I--*-
ATGTAAAAATCTGA
              
--------------
--------------