Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000184546 (click for geneview)
Transcript ID ENST00000330595(link to ensembl)
Symbol CTAGE1
Localtion Chromosome:18:18248591:18248815:-1 band: 18q11.2
Description Cutaneous T-cell lymphoma-associated antigen 1 (cTAGE-1 protein). [Source:Uniprot/SWISSPROT;Acc:Q9HC47]
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--F--V--I--I--S--L--H--N--C--V--V--I--S--F--V--L--F--L--F--G--G--N--N--F--I--Q--N--F--Y--L--P--Q--
ATGTTTGTCATCATATCATTACATAATTGTGTTGTTATTTCTTTTGTTTTATTTTTATTTGGTGGGAACAACTTTATCCAGAACTTTTACTTGCCCCAGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
N--Y--I--D--Q--F--L--L--T--S--F--P--T--F--T--S--V--G--V--L--I--V--L--V--L--C--S--A--F--L--L--L--W--Q
ATTATATAGATCAGTTTCTCCTGACTTCTTTCCCAACCTTTACCTCTGTTGGTGTTCTAATAGTTTTAGTTTTATGTTCTGCTTTTCTCTTGCTGTGGCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------>
--G--E--G--V--N--L--R--*-
AGGGGAAGGAGTAAATCTAAGATAG
                         
-------------------------
-------------------------