Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000184095 (click for geneview)
Transcript ID ENST00000331541(link to ensembl)
Localtion Chromosome:15:19061634:19064501:-1 band: 15q11.2
Description  
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--E--K--M--L--F--P--L--K--S--P--S--A--T--W--L--G--P--S--S--T--P--W--I--V--D--F--I--L--T--S--V--W--
ATGGAAAAAATGCTCTTTCCTCTGAAGAGCCCTAGTGCCACGTGGCTGGGCCCCAGCTCCACTCCCTGGATTGTGGATTTCATCCTCACCTCAGTGTGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------------------------------><-------------
S--L--G--F--L--F--L--L--A--P--Y--L--P--S--V--P--P--S--P--P--H--G--R--K--R--S--S--R--K--H--Q--R--K--R
GCCTGGGCTTCCTCTTCCTATTAGCCCCCTACCTCCCCAGTGTCCCACCCTCACCCCCGCATGGGAGGAAGAGGAGCAGCAGGAAGCATCAAAGGAAGAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------><-------------------------------------------------------
--E--G--R--P--R--S--R--K--K--I--P--A--L--N--S--C--R--I--L--L--R--E--L--E--E--T--Q--D--L--T--N--L--L-
AGAGGGGAGGCCCAGGAGCAGAAAGAAGATCCCAGCTCTGAATTCTTGCAGAATCCTCCTGAGGGAGCTGGAGGAGACTCAGGACCTGACCAACCTTCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----><--------------------------------------------------------><------------------------------------
-E--S--H--L--R--K--L--T--G--E--G--G--S--H--L--P--L--G--G--E--P--G--D--M--Y--K--P--A--P--A--K--A--H--
GAAAGCCACCTGAGAAAGCTCACTGGGGAGGGTGGCTCCCATCTGCCCTTAGGTGGAGAGCCCGGTGATATGTACAAACCAGCTCCTGCTAAGGCCCACC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
Q--P--H--R--K--C--M--Q--D--P--S--P--D--S--L--S--P--R--T--P--P--V--P--L--A--S--N--L--S--P--D--T--M--T
AGCCGCATAGGAAATGCATGCAAGATCCATCTCCTGACAGCTTGTCCCCAAGGACTCCCCCAGTTCCTCTGGCCTCCAACCTGTCACCAGACACAATGAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------------------------------------------><--
--F--S--E--P--F--G--P--R--S--T--L--S--A--S--R--P--P--E--P--L--L--P--L--K--C--P--A--V--R--P--H--M--F-
CTTCTCAGAGCCTTTTGGACCACGCTCAACCCTGAGTGCCTCCAGGCCTCCAGAGCCCTTGCTTCCCCTAAAATGCCCTGCAGTCCGGCCACATATGTTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-P--S--S--P--Q--P--H--V--P--V--A--S--S--P--P--P--P--E--H--S--L--A--G--L--Q--C--G--S--T--I--C--P--V--
CCTTCTTCACCACAGCCCCATGTTCCCGTGGCCTCCTCTCCACCTCCACCCGAACACAGCCTGGCTGGACTTCAGTGTGGCTCCACAATATGCCCTGTCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
P--Q--S--S--P--L--H--N--Q--G--P--P--S--P--T--R--V--I--S--G--L--G--C--S--S--G--P--I--R--D--L--S--R--W
CCCAGAGCTCCCCTCTACACAACCAGGGGCCACCTTCTCCAACCAGGGTGATCTCTGGCCTTGGGTGCTCCAGCGGTCCCATCCGGGACCTCTCCCGCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--R--E--A--A--T--T--W--G--L--S--T--C--S--Q--G--K--S--Q--Q--Q--H--L--P--N--H--P--P--E--A--S--F--W--G-
GAGGGAGGCTGCCACCACCTGGGGCCTCTCCACCTGCTCACAGGGCAAATCCCAGCAACAGCATCTTCCCAACCACCCCCCAGAGGCTTCCTTCTGGGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------><------------------------
-D--P--T--P--R--Q--M--E--A--G--G--R--T--F--F--H--P--N--V--Q--K--L--L--E--T--I--S--K--R--A--V--M--K--
GACCCCACACCCAGGCAGATGGAGGCAGGTGGACGCACATTCTTCCATCCCAACGTGCAGAAGCTGCTGGAGACTATCTCCAAGAGAGCAGTGATGAAGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
M--W--Q--E--K--E--W--G--W--A--D--Y--P--Q--M--T--S--L--G--K--E--W--D--I--T--T--L--N--P--F--W--N--V--A
TGTGGCAGGAGAAAGAATGGGGGTGGGCAGACTACCCGCAGATGACATCACTGGGGAAGGAGTGGGACATCACGACTCTAAATCCCTTCTGGAACGTGGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--N--L--P--Q--K--L--P--H--P--Q--Q--V--S--D--A--M--A--M--W--D--H--L--E--Q--K--C--S--H--L--F--W--D--L-
AAACCTACCACAGAAGCTGCCCCATCCTCAGCAGGTCTCTGACGCCATGGCCATGTGGGACCACTTAGAGCAGAAATGCAGCCATCTCTTCTGGGATCTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-P--S--F--N--S--E--S--L--V--T--M--A--W--V--S--R--N--I--S--S--Q--N--E--H--S--V--P--S--D--K--A--S--T--
CCCTCTTTCAATAGCGAGTCCCTGGTGACCATGGCCTGGGTTTCTAGGAACATTTCCTCACAGAATGAGCACTCTGTACCATCGGATAAAGCCTCCACTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------->
S--L--P--G--E--T--E--V--E--T--P--S--Q--L-
CCCTTCCAGGTGAAACTGAGGTTGAGACACCCTCACAGCTT
                                         
-----------------------------------------
-----------------------------------------