Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000185669 (click for geneview)
Transcript ID ENST00000332281(link to ensembl)
Symbol SNAI3
Localtion Chromosome:16:87271592:87280290:-1 band: 16q24.3
Description Similar to snail homolog 3 (Drosophila) (Fragment). [Source:Uniprot/SPTREMBL;Acc:Q86SU5]
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<-----------------------------------------------><--------------------------------------------------
-H--S--S--H--R--V--P--N--Y--R--R--L--E--T--Q--R--E--I--N--G--A--C--S--A--C--G--G--L--V--V--P--L--L--
CACTCCAGCCACAGGGTCCCCAACTACCGGCGGCTGGAGACGCAGAGAGAAATCAATGGTGCCTGCTCTGCCTGTGGGGGGCTGGTGGTGCCCCTCCTCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
P--R--D--K--E--A--P--S--V--P--G--D--L--P--Q--P--W--D--R--S--S--A--V--A--C--I--S--L--P--L--L--P--R--I
CCCGAGACAAGGAGGCCCCTTCTGTGCCCGGTGACCTTCCCCAGCCCTGGGACCGCTCCTCGGCCGTCGCCTGCATCTCCCTGCCCCTCCTGCCACGGAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--E--E--A--L--G--A--S--G--L--D--A--L--E--V--S--E--V--D--P--R--A--S--R--A--A--I--V--P--L--K--D--S--L-
CGAGGAAGCTCTGGGGGCCTCTGGGCTGGACGCCTTGGAAGTCAGCGAGGTCGACCCTCGGGCCAGCCGGGCCGCCATTGTACCCCTCAAAGACAGCCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-N--H--L--N--L--P--P--L--L--V--L--P--T--R--W--S--P--T--L--G--P--D--R--H--G--A--P--E--K--L--L--G--A--
AACCACCTCAACCTGCCCCCACTGCTGGTGCTGCCCACACGGTGGTCCCCGACCTTGGGCCCAGACCGGCACGGGGCTCCGGAAAAACTGCTTGGGGCTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
E--R--M--P--R--A--P--G--G--F--E--C--F--H--C--H--K--P--Y--H--T--L--A--G--L--A--R--H--R--Q--L--H--C--H
AGCGGATGCCCCGAGCCCCGGGCGGCTTTGAGTGCTTCCACTGCCACAAACCCTACCACACGCTGGCCGGGCTGGCCAGGCACCGGCAGCTGCACTGCCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--L--Q--V--G--R--V--F--T--C--K--Y--C--D--K--E--Y--T--S--L--G--A--L--K--M--H--I--R--T--H--T--L--P--C-
CCTGCAGGTGGGGCGTGTCTTCACCTGCAAGTACTGCGACAAGGAGTACACCAGCCTGGGTGCCCTCAAGATGCACATCCGCACTCACACGCTGCCCTGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------------------------------------------------><-----------------------------
-T--C--K--I--C--G--K--A--F--S--R--P--W--L--L--Q--G--H--V--R--T--H--T--G--E--K--P--Y--A--C--S--H--C--
ACCTGCAAGATCTGTGGCAAGGCCTTCTCCAGGCCCTGGTTACTGCAGGGCCATGTCCGCACCCACACAGGGGAGAAGCCCTATGCCTGCTCGCACTGCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
S--R--A--F--A--D--R--S--N--L--R--A--H--L--Q--T--H--S--D--A--K--K--Y--R--C--R--R--C--T--K--T--F--S--R
GCAGGGCCTTTGCCGACCGCTCCAACCTTCGGGCCCATCTGCAAACGCACTCAGACGCCAAGAAGTACCGGTGCCGGCGCTGCACCAAGACCTTCTCCCG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------->
--M--S--L--L--A--R--H--E--E--S--G--C--C--P--G--P--*-
CATGTCCCTCCTGGCGCGGCATGAGGAGTCTGGCTGCTGCCCGGGCCCCTGA
                                                    
----------------------------------------------------
----------------------------------------------------