Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000116721 (click for geneview)
Transcript ID ENST00000332296(link to ensembl)
Symbol YAX1_HUMAN
Localtion Chromosome:1:12785812:12856507:1 band: 1p36.21
Description Hypothetical protein DJ1198H6.1.
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-M--S--I--Q--A--P--P--R--L--L--E--L--A--G--Q--S--L--L--R--D--Q--A--L--S--I--S--A--M--E--E--L--P--R--
ATGAGCATCCAGGCCCCACCCAGACTACTGGAGCTGGCAGGGCAGAGCCTGCTGAGAGACCAGGCCTTGTCCATCTCTGCCATGGAGGAGCTGCCCAGGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
V--L--Y--L--P--L--F--M--E--A--F--S--R--R--H--F--Q--T--L--T--V--M--V--Q--A--W--P--F--T--C--L--P--L--G
TGCTCTATCTCCCACTCTTCATGGAGGCCTTCAGCAGGAGACACTTCCAGACTCTGACGGTGATGGTTCAGGCCTGGCCCTTCACCTGCCTCCCTCTGGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--------------------------------------------------------------------------------------><------------
--S--L--M--K--T--L--H--L--E--T--L--K--A--L--L--E--G--L--H--M--L--L--T--Q--K--D--R--P--R--R--W--K--L-
ATCACTGATGAAGACGCTTCATTTGGAGACCTTAAAAGCATTGCTGGAAGGGCTTCATATGCTGCTTACACAGAAGGATCGCCCCAGGAGGTGGAAACTT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-Q--V--L--D--L--R--D--V--D--E--N--F--W--A--R--W--P--G--A--W--A--L--S--C--F--P--E--T--T--S--K--R--Q--
CAAGTGCTGGATTTGCGGGATGTTGACGAGAATTTCTGGGCCAGATGGCCTGGAGCCTGGGCCCTGTCCTGCTTCCCAGAGACCACGAGTAAGAGGCAGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
T--A--E--D--C--P--R--M--G--E--H--Q--P--L--K--V--F--I--D--I--C--L--K--E--I--P--Q--D--E--C--L--R--Y--L
CAGCAGAGGACTGTCCAAGGATGGGAGAGCACCAGCCCTTAAAGGTGTTCATAGACATCTGCCTCAAGGAAATACCCCAGGATGAATGCCTGAGATACCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--F--Q--W--V--Y--Q--R--R--G--L--V--H--L--C--C--S--K--L--V--N--Y--L--T--P--I--K--Y--L--R--K--S--L--K-
CTTCCAGTGGGTTTACCAAAGGAGAGGTTTAGTACACCTGTGCTGTAGTAAGCTGGTCAATTATCTAACGCCGATTAAATATCTCAGAAAGTCATTGAAA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-I--I--Y--L--N--S--I--Q--E--L--E--I--R--N--M--S--W--P--R--L--I--R--K--L--R--C--Y--L--K--E--M--K--N--
ATAATATACCTGAATAGTATTCAAGAGCTGGAAATTCGCAACATGTCCTGGCCACGTCTGATAAGAAAGCTTCGTTGTTACCTGAAGGAGATGAAGAATC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
L--R--K--L--V--F--S--R--C--H--H--Y--T--S--D--N--E--L--Q--G--R--L--V--A--K--F--S--S--V--F--L--R--L--E
TTCGCAAACTCGTTTTCTCCAGGTGCCATCATTACACGTCAGATAATGAACTCCAAGGACGGTTAGTTGCCAAATTCAGCTCTGTGTTCCTCAGGCTGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-----------------------------------------------------------------><---------------------------------
--H--L--Q--L--L--K--I--K--L--I--T--F--F--S--G--H--L--E--Q--L--I--R--C--L--Q--N--P--L--E--N--L--E--L-
ACACCTTCAGTTGCTTAAAATAAAATTGATCACCTTCTTCAGTGGGCACCTGGAACAGCTGATCAGGTGCCTCCAGAACCCCTTGGAGAACTTGGAATTA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-T--Y--G--Y--L--L--E--E--D--M--K--C--L--S--Q--Y--P--S--L--G--Y--L--K--H--L--N--L--S--Y--V--L--L--F--
ACTTATGGCTACCTATTGGAAGAAGACATGAAGTGTCTCTCCCAGTACCCAAGCCTCGGTTACCTAAAGCATCTGAATCTCAGCTACGTGCTGCTGTTCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
R--I--S--L--E--P--L--G--A--L--L--E--K--I--A--A--S--L--K--T--L--I--L--E--G--C--Q--I--H--Y--S--Q--L--S
GCATCAGTCTTGAACCCCTCGGAGCTCTGCTGGAGAAAATTGCTGCCTCTCTCAAAACCCTCATCTTGGAGGGCTGTCAGATCCACTACTCCCAACTCAG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--A--I--L--P--A--L--S--R--C--S--Q--L--T--T--F--Y--F--G--R--N--C--M--S--I--D--A--L--K--D--L--L--R--H-
TGCCATCCTGCCTGCCCTGAGCCGGTGCTCCCAGCTCACCACCTTCTACTTTGGCAGAAATTGCATGTCTATTGACGCCCTGAAGGACCTGCTGCGCCAC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-T--S--G--L--S--K--L--S--L--E--T--Y--P--A--P--E--E--S--L--N--S--L--V--R--V--N--W--E--I--F--T--P--L--
ACCAGTGGGCTGAGCAAGTTAAGCCTGGAGACGTATCCTGCCCCTGAGGAGAGTTTGAATTCCTTGGTTCGTGTCAATTGGGAGATCTTCACCCCACTTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
R--A--E--L--M--C--T--L--R--E--V--R--Q--P--K--R--I--F--I--G--P--T--P--C--P--S--C--G--S--S--P--S--E--E
GGGCTGAGCTGATGTGTACACTGAGGGAAGTCAGGCAGCCCAAGAGGATCTTCATTGGCCCCACCCCCTGCCCTTCCTGTGGCTCATCACCGTCTGAGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------>
--L--E--L--H--L--C--C--*-
ACTGGAGCTCCATCTTTGCTGCTAG
                         
-------------------------
-------------------------