Sequences
EST Library Info
Clusters
Oligos
SNPs

Gene ID ENSG00000182157 (click for geneview)
Transcript ID ENST00000333222(link to ensembl)
Localtion Chromosome:16:87789672:87793725:-1 band: 16q24.3
Description  
Phylogenetic trees Goto TreeFam
Found Homolog NO

Show assembled from
↑ Human UTR Coding Intron   Pig Cluster reads Sequence EST Sequence Oligo  
↓Quality Color Table
not available >=0 - <20 >=20 - <40 >=40 - <60 >=60 - <80 >=80 - <100
<---------------------------------------------------------------------------------------------------
-W--N--L--V--C--G--D--G--W--K--V--P--L--E--Q--V--S--H--L--L--G--W--L--L--G--C--V--I--L--G--A--G--C--
TGGAACCTTGTGTGTGGAGACGGCTGGAAGGTCCCGCTGGAGCAGGTGAGCCACCTCCTGGGCTGGCTGCTGGGCTGTGTCATCCTGGGAGCAGGCTGTG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---><-----------------------------------------------------------------------------------------------
D--R--F--G--R--R--A--V--F--V--A--S--L--V--L--T--T--G--L--G--A--S--E--A--L--A--A--S--F--P--T--L--L--V
ACCGGTTTGGACGCCGGGCAGTTTTTGTGGCCTCCCTGGTGCTGACCACAGGCCTGGGGGCCAGTGAGGCCCTGGCTGCCAGCTTCCCTACCCTGCTGGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------><----------------------------------------
--L--R--L--L--H--G--G--T--L--A--G--A--L--L--A--L--Y--L--A--R--L--E--L--C--D--P--P--H--R--L--A--F--S-
CCTGCGCCTACTCCACGGGGGCACATTGGCAGGGGCCCTCCTCGCCCTGTATCTGGCTCGCCTGGAGTTGTGTGACCCTCCCCACCGCCTGGCCTTCTCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-M--G--A--G--L--F--S--V--V--G--T--L--L--L--P--G--L--A--A--L--V--Q--D--W--R--L--L--Q--G--L--G--A--L--
ATGGGGGCTGGCCTTTTCTCGGTGGTGGGCACCCTGCTGCTGCCCGGCCTGGCTGCGCTTGTGCAGGACTGGCGTCTTCTGCAGGGGCTGGGTGCCCTGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

---------------------------><-----------------------------------------------------------------------
M--S--G--L--L--L--L--F--W--G--F--P--A--L--F--P--E--S--P--C--W--L--L--A--T--G--Q--V--A--R--A--R--K--I
TGAGTGGACTCTTGCTGCTCTTTTGGGGGTTCCCGGCCCTGTTCCCCGAGTCTCCCTGCTGGCTGCTGGCCACAGGTCAGGTAGCTCGAGCCAGGAAGAT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

-------------------------------------------------------------------------><-------------------------
--L--W--R--F--A--E--A--S--G--V--G--P--G--D--S--S--L--E--E--N--S--L--A--T--E--L--T--M--L--S--A--R--S-
CCTGTGGCGCTTTGCAGAAGCCAGTGGCGTGGGCCCCGGGGACAGTTCCTTGGAGGAGAACTCCCTGGCTACAGAGCTGACCATGCTGTCTGCACGGAGC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------><----------------
-P--Q--P--R--Y--H--S--P--L--G--L--L--R--T--R--V--T--W--R--N--G--L--I--L--G--F--S--S--L--V--G--G--G--
CCCCAGCCCCGGTACCACTCCCCACTGGGGCTTCTGCGTACCCGAGTCACCTGGAGAAACGGGCTTATCTTGGGCTTCAGCTCGCTGGTTGGTGGAGGCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
I--R--A--S--F--R--R--S--L--A--P--Q--V--P--T--F--Y--L--P--Y--F--L--E--A--G--L--E--A--A--A--L--V--F--L
TCAGAGCTAGCTTCCGCCGCAGCCTGGCACCTCAGGTGCCGACCTTCTACCTGCCCTACTTCCTGGAGGCCGGCCTGGAGGCGGCAGCCTTGGTCTTCCT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--L--L--T--A--D--C--C--G--R--R--P--V--L--L--L--G--T--M--V--T--G--L--A--S--L--L--L--L--A--G--A--Q--C-
GCTCCTGACGGCAGATTGCTGTGGACGCCGCCCCGTGCTGCTGCTGGGCACCATGGTCACAGGCCTGGCATCCCTGCTGCTCCTCGCTGGGGCCCAGTGT
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------><----------------------------------------------------------------
-E--L--G--A--P--Q--A--I--Q--E--P--L--V--E--G--L--G--R--E--P--G--N--P--C--S--L--S--P--D--L--P--G--W--
GAGCTTGGGGCCCCGCAGGCCATACAGGAGCCATTGGTGGAAGGCCTGGGGAGAGAGCCTGGGAACCCCTGTTCTTTGTCCCCAGATCTGCCAGGCTGGA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

------------------------------------------------------------------------------------------------><--
T--V--L--F--L--S--V--L--G--L--L--A--S--R--A--V--S--A--L--S--S--L--F--A--A--E--V--F--P--T--V--I--R--G
CTGTGCTGTTCCTCTCTGTCCTGGGGCTCCTGGCCTCCCGGGCTGTGTCCGCACTCAGCAGCCTCTTCGCGGCCGAGGTCTTCCCCACGGTGATCAGGGG
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
--A--G--L--G--L--V--L--G--A--G--F--L--G--Q--A--A--G--P--L--D--T--L--H--G--R--Q--G--F--F--L--Q--Q--V-
GGCCGGGCTGGGCCTGGTGCTGGGGGCCGGGTTCCTGGGCCAGGCAGCCGGCCCCCTGGACACCCTGCACGGCCGGCAGGGCTTCTTCCTGCAACAAGTC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
-V--F--A--S--L--A--V--L--A--L--L--C--V--L--L--L--P--E--S--R--S--R--G--L--P--Q--S--L--Q--D--A--D--R--
GTCTTCGCCTCCCTTGCTGTCCTTGCCCTGCTGTGTGTCCTGCTGCTGCCTGAGAGCCGAAGCCGGGGGCTGCCCCAGTCACTGCAGGACGCCGACCGCC
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

----------------------------------------------------------------------------------------------------
L--R--R--S--P--L--L--R--G--R--P--R--Q--D--H--L--P--L--L--P--P--S--N--S--Y--W--A--G--H--T--P--E--Q--H
TGCGCCGCTCCCCACTCCTGCGGGGCCGCCCCCGCCAGGACCACCTGCCTCTGCTGCCGCCCTCCAACTCCTACTGGGCCGGCCACACCCCCGAGCAGCA
                                                                                                    
----------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------

--->
--*-
CTAG
    
----
----